... 5859 Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium A. Pappachan 1 , H. S. Savithri 2 and M. R. N. Murthy 1 1 Molecular ... (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI site. The gene...
Ngày tải lên: 18/02/2014, 14:20
... determination and biochemical studies on Bacillus stearothermophilus E53Q serine hydroxymethyltransferase and its complexes provide insights on function and enzyme memory V. Rajaram 1 *, B. S. Bhavani 3 *, ... Crystal structure of E53QbsSHMT and its complexes FEBS Journal 274 (2007) 4148–4160 ª 2007 The Authors Journal compilation ª 2007 FEBS 41...
Ngày tải lên: 18/02/2014, 16:20
Effects of simultaneous doping with boron and phosphorous on the structural, electronic and optical properties of silicon nanostructures
... asymptotically the value of the band-gap of the undoped Si-nw. This is another indication of how doping can modify the electronic and optical properties of the Si nanostructures. 6. Conclusions The structural, ... 941 Effects of simultaneous doping with boron and phosphorous on the structural, electronic and optical properties...
Ngày tải lên: 16/03/2014, 15:15
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx
... 4-deoxy- D - arabino -hexose- containing O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) Ewa Katzenellenbogen 1 , Nina A. Kocharova 2 , George V. Zatonsky 2 , Danuta Witkowska 1 , ... NaCl/P i (PBS) containing 1% polyethylene glycol 6000. Results and discussion Isolation and chemical analysis of the O-spec...
Ngày tải lên: 23/03/2014, 17:22
Báo cáo hóa học: " Electrical Conductivity Studies on Individual Conjugated Polymer Nanowires: Two-Probe and Four-Probe Resu" potx
... EXPRESS Electrical Conductivity Studies on Individual Conjugated Polymer Nanowires: Two-Probe and Four-Probe Results Yun Ze Long ã Jean Luc Duvail ã Meng Meng Li ã Changzhi Gu ã Zongwen Liu ã Simon P. Ringer Received: ... a relatively high electrical conductivity at room temperature. Conclusions In summary, we have performed two- and four-probe electrical measu...
Ngày tải lên: 22/06/2014, 00:20
Báo cáo hóa học: " Research Article Audio Key Finding: Considerations in System Design and Case Studies on Chopin’s 24 Preludes" pdf
... Publishing Corporation EURASIP Journal on Advances in Signal Processing Volume 2007, Article ID 56561, 15 pages doi:10.1155/2007/56561 Research Article Audio Key Finding: Considerations in System Design and ... and interna- tional conferences such as the International Conference on Music Information Retrieval (ISMIR), International Conference on Mul- timedia a...
Ngày tải lên: 22/06/2014, 23:20
Assessing the Impact of Transport and Energy Infrastructure on Poverty ReductionCynthia pdf
... care and education and enhances the contact and communica- tion of the poor with the outside world. However, the team found that the positive impacts of transport and energy investments on the ... Pacific, the roles of growth and social development and of infrastruc- ture in poverty reduction, the impact of the PRS on coun- try-level operati...
Ngày tải lên: 27/06/2014, 07:20
Assessing the Impact of Transport and Energy Infrastructure on Poverty Reduction - Chapter 4 doc
... Impact of Transport and Energy Infrastructure on Poverty Reduction Environment The construction and operation of infrastructure projects often involves significant impacts on the physical environment ... like this one in Nakhon Ratchasima, Northeast Thailand, to earn cash income. 44 Assessing the Impact of Transport and Energy Infrastructure on...
Ngày tải lên: 08/08/2014, 10:23
Assessing the Impact of Transport and Energy Infrastructure on Poverty Reduction - Chapter 5 pdf
... 86 Assessing the Impact of Transport and Energy Infrastructure on Poverty Reduction The team examined 15 combinations of transport, energy, credit, and technical support interventions on the basis ... (n=131) (n=1 65) Family Size 4.67 4.94 4.84 4 .58 4.68 4.79 4.73 4.48 Labor Force Participation 0 .55 0 .52 0 .54 0 .57 0 .54 0 .53 0 .52 0 .56 Average Educa...
Ngày tải lên: 08/08/2014, 10:23
transport and optical studies on individual nanostructures
Ngày tải lên: 13/11/2014, 15:57