Báo cáo y học: "MONKEY: identifying conserved transcription-factor binding sites in multiple alignments using a binding site-specific evolutionary model" ppsx

Báo cáo y học: "MONKEY: identifying conserved transcription-factor binding sites in multiple alignments using a binding site-specific evolutionary model" ppsx

Báo cáo y học: "MONKEY: identifying conserved transcription-factor binding sites in multiple alignments using a binding site-specific evolutionary model" ppsx

... CATTTGCCACTCACGAACAAGAATAAAAGAATTTAGGTATTCTAGAATGCCCAAAAGGTAACGGCAATACA YLR387C_Skud AAATTGCCACTTACGAAGGAGAATAAAACAGCTCAGATATTCTTAGACACTCCAAGGGCAGTGACAATACA YLR387C_Sbay AAATTGCCACTCAGGAAAGAGAAGTGATATAATTAGATGTTCT ... region. YLR387C_Scer AAATTGCCACTCACGAAAGAGAATAAAACGACTTAGTCAT-ATGCAATAGTCACAAGACGGTGGCAACACA YLR387C_Spar AAATTGCCACTCACGAAGGAGAATAAAACAACTCAGTCGTCATGCAATACCCAAAAGACGGTGGCAATAAA...

Ngày tải lên: 14/08/2014, 14:21

15 289 0
Tài liệu Báo cáo Y học: Prediction of protein–protein interaction sites in heterocomplexes with neural networks ppt

Tài liệu Báo cáo Y học: Prediction of protein–protein interaction sites in heterocomplexes with neural networks ppt

... predicted as receptor -binding domains [26] and a Supp ort Vector Machine learning system was trained to recognize and predict interactions based solely on primary structure and associated physico-chemical ... protein–protein interfaces taken from the PDB database indicates that hydrophobic residues are abundant in large interfaces while polar residues are more abundant in small intera...

Ngày tải lên: 21/02/2014, 15:20

6 455 0
Báo cáo y học: "Risk factors associated with mental illness in Oyo State, Nigeria: A Community based study" pps

Báo cáo y học: "Risk factors associated with mental illness in Oyo State, Nigeria: A Community based study" pps

... Health, Saki East Local Govt Area, Oyo State, Nigeria Email: OE Amoran* - drfamoran@yahoo.com; TO Lawoyin - tlawoyin@skannet.com; OO Oni - rindeoni@yahoo.com * Corresponding author Abstract Background: ... all the local government areas in Oyo state was drawn and stratified into urban and rural areas based on World bank classification [9]. One rural and two urban local government areas wa...

Ngày tải lên: 08/08/2014, 21:20

6 422 0
Báo cáo y học: "Do the pleiotropic effects of statins in the vasculature predict a role in inflammatory diseases" pdf

Báo cáo y học: "Do the pleiotropic effects of statins in the vasculature predict a role in inflammatory diseases" pdf

... statins are currently available within the UK: pravastatin, simvastatin, fluvastatin, atorvastatin and rosuvastatin; in addition, lovastatin is available in other countries. Cerivastatin has been ... Sparrow and colleagues demonstrated that simvastatin had a comparable anti- inflammatory effect to that of indomethacin in the carrageenan-induced foot pad oedema inflammatory model [43]....

Ngày tải lên: 09/08/2014, 06:22

7 336 0
Báo cáo y học: "New classification of HLA-DRB1 alleles in rheumatoid arthritis susceptibility: a combined analysis of worldwide samples" docx

Báo cáo y học: "New classification of HLA-DRB1 alleles in rheumatoid arthritis susceptibility: a combined analysis of worldwide samples" docx

... HLA shared-epitope genotypes for rheumatoid arthritis. Am J Hum Genet 1996, 58:371-383. 23. Kochi Y, Yamada R, Kobayashi K, Takahashi A, Suzuki A, Sekine A, Mabuchi A, Akiyama F, Tsunoda T, Nakamura ... USA) and the help of technical and clinical collaborators from the rheumatoid arthritis international working group, for clinical data management and laboratory typings. The authors a...

Ngày tải lên: 09/08/2014, 10:23

8 342 0
Báo cáo y học: "Antiretroviral treatment adherence and its determinants in Sub-Saharan Africa: a prospective study at Yaounde Central Hospital, Cameroon" pdf

Báo cáo y học: "Antiretroviral treatment adherence and its determinants in Sub-Saharan Africa: a prospective study at Yaounde Central Hospital, Cameroon" pdf

... characteristics and pharmacy adherence As patients lost to follow-up may have introduced bias into the analysis, we analysed the association of individ- ual patient characteristics with pharmacy ... Kinge: scientific advisor and technical assistance; Bibiane Bekono Ntsama: data cleaning and processing; Dominique Roulin, Prof Jean-François Balavoine, Eric Linder and Renaud Gautier: main ......

Ngày tải lên: 10/08/2014, 05:21

12 317 0
Báo cáo y học: "Three variations of the laryngeal nerve in the same patient: a case report" potx

Báo cáo y học: "Three variations of the laryngeal nerve in the same patient: a case report" potx

... posterior branch also has motor fibers, and may affect laryngeal function. It may innervate posterior cr icoarytenoid (abductor function) and interarytenoid muscles [4]. Extra-laryngeal terminal division ... SILAB appeared as additional third variation of RLN in our patient. Extra-laryngeal bifurcation of the non-recurrent ILN is an extremely unusual anatomic finding. Association of two ana...

Ngày tải lên: 10/08/2014, 23:21

5 494 0
Báo cáo y học: "Gabapentin for complex regional pain syndrome in Machado-Joseph disease: a case report" pot

Báo cáo y học: "Gabapentin for complex regional pain syndrome in Machado-Joseph disease: a case report" pot

... worldwide and is caused by a CAG trinucleotide repeat expansion in the coding region of the MJD1 gene. The main features of MJD are ataxia and ophthalmoparesis and pyramidal, extrapyram idal, and amyotrophic ... visual analogue scale (VAS) (0 for no pain and 10 for maximal pain) to mea- sure his pain intensity [3]. Initially, his pain was mini- mally relieved, from 10 to 8 on the VAS, by...

Ngày tải lên: 10/08/2014, 23:21

3 421 0
Báo cáo y học: "Calcified amorphous tumor of the heart in an adult female: a case report" potx

Báo cáo y học: "Calcified amorphous tumor of the heart in an adult female: a case report" potx

... residual calcium may be seen [2]. One case of a recurrent cardiac CAT in a young patient has also been reported [3]. Another patient, a 60-year-old woman, had a fatal outcome of a cardiac CAT involving right ... Marusaki S, Moniwa N, Oh-numa Y, Kuno A, Takagi S, Takizawa H, Ura N, Shimamoto K: Mobile intracardiac calcinosis: a new risk of thromboembolism in patients with ha...

Ngày tải lên: 11/08/2014, 03:21

3 316 0
Báo cáo y học: "Calcified amorphous tumor of the heart in an adult female: a case report" docx

Báo cáo y học: "Calcified amorphous tumor of the heart in an adult female: a case report" docx

... impera- tive to exclude underlying myxomas [2]. In our case, extensive sampling failed to reveal any myxomatous tis- sue. Cardiac vegetations are intimately associated with valve leaflets and may ... histological differential diagnoses for car- diac CAT include myxoma, vegetations, Echinococcus cysts and thrombi. A small fraction of myxomas may cal- cify and even ossify; hence, adequate s...

Ngày tải lên: 11/08/2014, 07:20

3 534 0
w