Báo cáo sinh học: "Prediction error variance and expected response to selection, when selection is based on the best predictor for Gaussian and threshold characters, traits following a Poisson mixed model and survival traits" potx

Báo cáo sinh học: "Prediction error variance and expected response to selection, when selection is based on the best predictor for Gaussian and threshold characters, traits following a Poisson mixed model and survival traits" potx

Báo cáo sinh học: "Prediction error variance and expected response to selection, when selection is based on the best predictor for Gaussian and threshold characters, traits following a Poisson mixed model and survival traits" potx

... expected response to selection, when selection is based on the best predictor - for Gaussian and threshold characters, traits following a Poisson mixed model and survival traits Inge Riis K ORSGAARD a , Anders ... expected response to selection on the additive genetic scale and on the observed scale. The expressions gi...

Ngày tải lên: 14/08/2014, 13:21

27 254 0
Báo cáo sinh học: " Research Article Approximation of Solution of Some m-Point Boundary Value Problems on Time Scales Rahmat Ali Khan1 and Mohammad Rafique2 1" pot

Báo cáo sinh học: " Research Article Approximation of Solution of Some m-Point Boundary Value Problems on Time Scales Rahmat Ali Khan1 and Mohammad Rafique2 1" pot

... Quasilinearization for Nonlinear Problems, vol. 440 of Mathematics and Its Applications, Kluwer Academic Publishers, Dordrecht, The Netherlands, 1998. 25 V. Lakshmikantham and A. S. Vatsala, “Generalized ... 2001. Advances in Difference Equations 11 6 D. Anderson, R. Avery, and J. Henderson, “Existence of solutions for a one dimensional p-Laplacian on time-scales,” Journal...

Ngày tải lên: 21/06/2014, 16:20

11 329 0
Báo cáo sinh học: "Transcription in mosquito hemocytes in response to pathogen exposure" ppt

Báo cáo sinh học: "Transcription in mosquito hemocytes in response to pathogen exposure" ppt

... that they are unable to transmit disease-causing pathogens, and to mass release them into the environment to displace natural populations of susceptible mosquitoes. Before such a strategy can ... eexxppaannddeedd ppaatttteerrnn rreeccooggnniittiioonn ccaappaacciittyy aaggaaiinnsstt bbaacctteerriiaa aanndd mmaallaarriiaa ppaarraassiitteess J Biol Chem 2009, 228844:: 9835-9844. 1...

Ngày tải lên: 06/08/2014, 19:20

4 287 0
Báo cáo sinh học: " A strategy of tumor treatment in mice with doxorubicin-cyclophosphamide combination based on dendritic cell activation by human double-stranded DNA preparation" doc

Báo cáo sinh học: " A strategy of tumor treatment in mice with doxorubicin-cyclophosphamide combination based on dendritic cell activation by human double-stranded DNA preparation" doc

... study and performed the statistical analysis. EVD carried out the mice experiments and performed the statistical analysis. ASP carried out the mice experiments and drafted the manuscript. KEO participated ... human dsDNA preparation 1 day ( on the day of CP injection), 3, 4, and 5 days after CP treatment. Three, 6, and 9 days later, the fraction of mononuclear cells...

Ngày tải lên: 14/08/2014, 19:22

10 255 0
Báo cáo y học: "Broader HIV-1 neutralizing antibody responses induced by envelope glycoprotein mutants based on the EIAV attenuated vaccin" ppt

Báo cáo y học: "Broader HIV-1 neutralizing antibody responses induced by envelope glycoprotein mutants based on the EIAV attenuated vaccin" ppt

... persisten ce and pathogenesis are very similar [3,4]. These similarities are based on the common genetic organization, the molecu- lar mechanism of viral replication, and the conforma- tional ... GCTCTAGAGATATCGACACCATGGACAGGGCCAAGCTGCTGCTG CN54145R GTGAACAGGGTGAGGCAGGGCTACTGAGGATCCGTCGACCG 145M1u ACCACCGAGTTCTGCGCCAGCGACG 145M1d CGCAGAACTCGGTGGTGGTGGCGCCCTTCCACACGG 145M2u AACCA...

Ngày tải lên: 13/08/2014, 01:20

13 307 0
Báo cáo sinh học: " Estimation of variance components of threshold characters by marginal posterior modes and means via " pptx

Báo cáo sinh học: " Estimation of variance components of threshold characters by marginal posterior modes and means via " pptx

... to the variance of the sample mean computed from the estimated autocorrelations (Sorensen et al, 1995). Autocovariance for lag t was estimated as Variance of sample mean ... applied to parameters and liabil- ities was implemented for Bayesian analysis of a binary trait. A simulation study was conducted to evaluate the accuracy of 3...

Ngày tải lên: 09/08/2014, 18:22

22 239 0
Báo cáo sinh học: "Prediction of genetic gains in body weight, egg production and shell quality traits in the Brown Tsaiya laying duck" pps

Báo cáo sinh học: "Prediction of genetic gains in body weight, egg production and shell quality traits in the Brown Tsaiya laying duck" pps

... females and 624 males), separately for males and females with the assumption E(B) = B. This assumption is more valid when there is a large number of animals. Theoretically, ... applied to a multiple trait animal model based on data of the first five generations of selection. The selection goals of this breeding program at pres...

Ngày tải lên: 09/08/2014, 18:22

13 305 0
Báo cáo sinh học: " Inferences about variance components and selection response for body weight in chickens" pdf

Báo cáo sinh học: " Inferences about variance components and selection response for body weight in chickens" pdf

... Mueller and James, 1983). Therefore, an evaluation of genetic variation and of selection response in populations with a long history of selection for growth rate is necessary ... average selection intensity over sexes and generations was approximately one phenotypic standard deviation. The approximate formula for predicting response to...

Ngày tải lên: 09/08/2014, 18:22

13 274 0
Báo cáo sinh học: "Prediction of plant promoters based on hexamers and random triplet pair analysis" ppt

Báo cáo sinh học: "Prediction of plant promoters based on hexamers and random triplet pair analysis" ppt

... cross validation. Rank Random Triplet Pair (RTP) 1 AAA-AAA 2 AAA-AAT 3 AAA-AGA 4 AAA-ATC 5 AAA-ATT 6 AAA-CAT 7 AAA-TTT 8 AAC-ATA 9 AAC-CGA 10 AAC-CTG Azad et al. Algorithms for Molecular Biology ... cross validation. Rank Common hexamers extracted from All 5 dataset (top 25%) 1 ATATAT 2 TATATA 3 ATATTT 4 TATAAA 5 AAAAAA 6 TTTTTT 7 AGAGAG 8 TCTCTC 9 CTCTCT 10 GAGAGA Azad et al. Algorithms f...

Ngày tải lên: 12/08/2014, 17:20

10 313 0
Báo cáo sinh học: " Prediction of haplotypes for ungenotyped animals and its effect on marker-assisted breeding value estimation" ppsx

Báo cáo sinh học: " Prediction of haplotypes for ungenotyped animals and its effect on marker-assisted breeding value estimation" ppsx

... used as nhc and the variance is the same as for NM. For CON- BLUP, Equation (3) is used without regression on nhc and the variance of the additive genetic effect is set to . For all evaluations, mixed ... contributions HAM developed the method, ran the simulations and evaluations and drafted the manuscript. MPLC and RFV discussed the method and...

Ngày tải lên: 14/08/2014, 13:21

15 384 0
w