Báo cáo y học: "Comparison between data obtained through real-time data capture by SMS and a retrospective telephone interview" ppsx

Báo cáo y học: "Comparison between single antiplatelet therapy and combination of antiplatelet and anticoagulation therapy for secondary prevention in ischemic stroke patients with antiphospholipid syndrome"

Báo cáo y học: "Comparison between single antiplatelet therapy and combination of antiplatelet and anticoagulation therapy for secondary prevention in ischemic stroke patients with antiphospholipid syndrome"

... Satisfactory results have not yet been obtained in therapy for secondary prevention in ischemic stroke patients with antiphospholipid syndrome (APS). We therefore compared single antiplatelet therapy ... therapy and a combination of antiplatelet and anticoagulation therapy for secondary prevention in ischemic stroke patients with AP...

Ngày tải lên: 26/10/2012, 09:48

4 604 0
Báo cáo y học: "Does eGFR improve the diagnostic capability of S-Creatinine concentration results? A retrospective population based study" ppsx

Báo cáo y học: "Does eGFR improve the diagnostic capability of S-Creatinine concentration results? A retrospective population based study" ppsx

... at S-Creatinine 100 àmol/L) and an age compensating factor of about 0,45 (0,54 at 20 years and 0,42 at 80 years) and a magnifying constant factor (174-186) will drastically change the diagnostic ... creatinine; therefore EQAS will only evaluate the measurement of creatinine, not the calculated quantity. The analytical “sensitivity” of S-Creatinine is slightly large...

Ngày tải lên: 08/08/2014, 16:23

9 348 0
Báo cáo y học: "Psoriatic arthritis synovial histopathology: commentary on the article by Kruithof and colleagues" pps

Báo cáo y học: "Psoriatic arthritis synovial histopathology: commentary on the article by Kruithof and colleagues" pps

... expressed by distinct cell popu- lations in inflamed synovium [abstract]. Arthritis Rheum 2002, 42:s568. 7. McGonagle D, Conaghan PG, Emery P: Psoriatic arthritis: a unified concept twenty years on. Arthritis ... Boots AM, Veys EM, De Keyser F: Synovial histopathology of psoriatic arthritis, oligo- and polyarticular, resembles more spondyloarthropathy than rheumatoid arthri- tis....

Ngày tải lên: 09/08/2014, 06:23

2 333 0
Báo cáo y học: "Comparison between partial ulnar and intercostal nerve transfers for reconstructing elbow flexion in patients with upper brachial plexus injurie" pot

Báo cáo y học: "Comparison between partial ulnar and intercostal nerve transfers for reconstructing elbow flexion in patients with upper brachial plexus injurie" pot

... Kakinoki et al.: Comparison between partial ulnar and intercostal nerve transfers for reconstructing elbow flexion in patients with upper brachial plexus injuries. Journal of Brachial Plexus and ... obtain M1, M3 in the elbow flexion, the time required for full flexion of the elbow joint against the gravity with the wrist and fingers maxi...

Ngày tải lên: 10/08/2014, 10:20

9 358 0
Báo cáo y học: "Split tendon transfers for the correction of spastic varus foot deformity: a case series study" ppsx

Báo cáo y học: "Split tendon transfers for the correction of spastic varus foot deformity: a case series study" ppsx

... of spastic varus foot deformity: a case series study Maria Vlachou 1* , Dimitris Dimitriadis 1,2 Abstract Background: Overactivity of anterior and/or posterior tibial tendon may be a causative ... Split tendon transfers for the correction of spastic varus foot deformity: a case series study. Journal of Foot and Ankle Research 2010 3:28. Subm...

Ngày tải lên: 10/08/2014, 21:24

11 449 0
Báo cáo y học: "Unusual primary HIV infection with colonic ulcer complicated by hemorrhagic shock: a case report" potx

Báo cáo y học: "Unusual primary HIV infection with colonic ulcer complicated by hemorrhagic shock: a case report" potx

... investigated, the patient had a life-threatening hematochezia. After angiographic occlusion of a branch of the ileocaecal artery and initiation of antiretroviral therapy, the patient became rapidly asymptomatic ... extremely high viral load. Introduction Patient s with primary HIV- 1 infection (PHI) may have a variety of symptoms, including flulike syndrome, lym- phadenopathy, ga...

Ngày tải lên: 11/08/2014, 03:21

5 301 0
Báo cáo y học: " Unusual primary HIV infection with colonic ulcer complicated by hemorrhagic shock: a case report" pptx

Báo cáo y học: " Unusual primary HIV infection with colonic ulcer complicated by hemorrhagic shock: a case report" pptx

... 4:279 http://www.jmedicalcasereports.com/content/4/1/279 Page 4 of 5 CAS E REP O R T Open Access Unusual primary HIV infection with colonic ulcer complicated by hemorrhagic shock: a case report Stephane Emonet 1* , ... description: A 42-year-old Caucasian man was treated with amoxicillin-clavulanate for pharyngitis. He did not improve, and a rash developed. Hi...

Ngày tải lên: 11/08/2014, 07:20

5 376 0
Báo cáo y học: "Egress of HSV-1 capsid requires the interaction of VP26 and a cellular tetraspanin membrane protein" doc

Báo cáo y học: "Egress of HSV-1 capsid requires the interaction of VP26 and a cellular tetraspanin membrane protein" doc

... respectively: 5'-GGATCCCGCAG GCC A A AG AC A AC A ATAG T GGTGCCAGTCAAGAGCTGGCACCACTATTGTTG TCTTTGGCCTGtcgtcagctcgtgccgtaag TGAA AC TAGT TACCAGATCATAACAACCCTCA AGAGG GTTGT TATGATC TGGTAACTAGTT TCA TTTTTTCTAGA-3' ... 5'- AGGCATGCCCATTGTTATCTG -3' and 5'- GAGA- CAATCGCGAACATCTAC -3', 5'- ATTCCACCCGCA TGGAGTTC -3' and 5'- CGGTGATGTTCGTCAG- GA...

Ngày tải lên: 12/08/2014, 04:20

12 302 0
Báo cáo y học: "Analysis of adenovirus trans-complementationmediated gene expression controlled by melanoma-specific TETP promoter in vitro" ppsx

Báo cáo y học: "Analysis of adenovirus trans-complementationmediated gene expression controlled by melanoma-specific TETP promoter in vitro" ppsx

... deliv- ery of therapeutic genes is one of the main goals of can- cer therapy, it may be of importance for the general usage of the binary Ad expression system to investigate whether this finding is ... within a few days, but frequently became undetectable by one month after injection. These findings were ascribed to either elimina- tion of viral genomes by the immune system...

Ngày tải lên: 12/08/2014, 04:20

17 412 0
Báo cáo y học: "Comparison of two percutaneous tracheostomy techniques, guide wire dilating forceps and Ciaglia Blue Rhino: a sequential cohort study" docx

Báo cáo y học: "Comparison of two percutaneous tracheostomy techniques, guide wire dilating forceps and Ciaglia Blue Rhino: a sequential cohort study" docx

... tracheostomy techniques, namely guide wire dilating forceps (GWDF) and Ciaglia Blue Rhino (CBR). Methods A sequential cohort study with comparison of short-term and long-term peri-operative and postoperative ... one of the three following techniques: guide wire dilating forceps (GWDF) tra- cheostomy, Ciaglia Blue Rhino (CBR) tracheostomy, and se...

Ngày tải lên: 12/08/2014, 20:20

7 348 0
Báo cáo y học: "Comparison between data obtained through real-time data capture by SMS and a retrospective telephone interview" ppsx

Báo cáo y học: "Comparison between data obtained through real-time data capture by SMS and a retrospective telephone interview" ppsx

... methods 0.1 days (-1 day: 0.9 day) 0.7 days (-4 days: 5 days) 36 days (-175 days: 103 days) Q2: Average difference between the two data capture methods 0.0 days 0.3 days (-3 days: 2.5 days) 26 days (-67 ... SMS by aggre- gating data from the corresponding 4 weeks obtained each week by SMS. The answer for the 1-year recall by telephone was compared with 1 year by SMS...

Ngày tải lên: 13/08/2014, 14:20

7 244 0
Báo cáo y học: "Comparison between Flotrac-Vigileo and Bioreactance, a totally noninvasive method for cardiac output monitoring" ppt

Báo cáo y học: "Comparison between Flotrac-Vigileo and Bioreactance, a totally noninvasive method for cardiac output monitoring" ppt

... the PAC-CCO was checked by systematic chest x- rays at 1, 4, and 12 hours postoperatively. Postoperative echocardiography was systematically performed, to check for intracardiac shunts and significant ... not for citation purposes) Vol 13 No 3 Research Comparison between Flotrac-Vigileo and Bioreactance, a totally noninvasive method for cardiac output monitoring...

Ngày tải lên: 13/08/2014, 16:20

6 411 0
Báo cáo y học: "Links between maternal postpartum depressive symptoms, maternal distress, infant gender and sensitivity in a high-risk population" ppt

Báo cáo y học: "Links between maternal postpartum depressive symptoms, maternal distress, infant gender and sensitivity in a high-risk population" ppt

... this article as: Sidor et al.: Links between maternal postpartum depressive symptoms, maternal distress, infant gender and sensitivity in a high-risk population. Child and Adolescent Psychiatry and ... significant effects. Association between infant gender, maternal depressive symptoms and sensitivity Two-way ANOVA with infant gender and matern...

Ngày tải lên: 13/08/2014, 18:21

7 276 0
Báo cáo y học: "Links between maternal postpartum depressive symptoms, maternal distress, infant gender and sensitivity in a high-risk population" ppsx

Báo cáo y học: "Links between maternal postpartum depressive symptoms, maternal distress, infant gender and sensitivity in a high-risk population" ppsx

... expected to increase in indirectly affected for sev- eral years after a large RTA. In this study, only changes in sadness and avoidance were de termined between 9 months and 4 years, whereas and there ... Sweden. Authors’ contributions FKA participated in the design of the study and acquisition of data, performed the data analysis and drafted the manuscript. PAR and TL...

Ngày tải lên: 13/08/2014, 18:21

8 208 0
Báo cáo y học: "Who benefits most from mild therapeutic hypothermia in coronary intervention era? A retrospective and propensity-matched study" ppsx

Báo cáo y học: "Who benefits most from mild therapeutic hypothermia in coronary intervention era? A retrospective and propensity-matched study" ppsx

... most from mild therapeutic hypothermia in coronary intervention era? A retrospective and propensity-matched study Eisuke Kagawa * , Ichiro Inoue, Takuji Kawagoe, Masaharu Ishihara, Yuji Shimatani, ... J, Kikushima K, Watanabe I: Cardiopulmonary cerebral resuscitation using emergency cardiopulmonary bypass, coronary reperfusion therapy and mild hypothermia in...

Ngày tải lên: 13/08/2014, 21:21

12 166 0
w