... Lucia, Australia A novel photoactivatable analog of antisauvagine-30 (aSvg- 30), a specific antagonist for corticotropin-releasing factor (CRF) receptor, type 2 (CRF 2 ), has been synthesized and characterized. ... indicated on the right and left. Ó FEBS 20 02 Photoactivatable CRF 2 receptor antagonist (Eur. J. Biochem. 26 9) 529 3 Development of a sele...
Ngày tải lên: 31/03/2014, 08:20
... membrane. J Rheumatol 1999, 26:2523-2528. 10. Yan SF, Ramasamy R, Naka Y, Schmidt AM: Glycation, inflam- mation and RAGE: a scaffold for the macrovascular complica- tions of diabetes and beyond. ... such as the following: Do plasma sRAGE levels vary from day to day in a subject? Do they vary over the lifespan of the individual? What were the levels of sRAGE in the RA subj...
Ngày tải lên: 09/08/2014, 06:23
Báo cáo y học: "Validation of a microwave radar system for the monitoring of locomotor activity in mic pptx
... housed individually in standard breeding cages. Methods Electronic system for the recording of locomotor activity The locomotor activity of the animal is recorded automat- ically by means of microwave radar based ... very long monitoring of the animals, creating continuous time series. The data files are automatically saved to the hard disk, allowing im...
Ngày tải lên: 10/08/2014, 09:20
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx
... (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAA GA) and allele- specific primer s Pnf (AGCATTTGGTTTTAAATTATG- GAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA). The PCR was run for 35 cycles ... K, Kameda T, Takenaka K, Oku S, Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K, Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primary myelofibrosis a...
Ngày tải lên: 10/08/2014, 21:23
Báo cáo y học: "Development of a synoptic MRI report for primary rectal cancer" ppsx
... develop a synoptic MRI report for primary rectal cancer, and to elicit the opinions of radiologists regarding enablers and barriers towards the implementation and sustainability of synop- tic reports ... present and describe key elements or templates for MRI reporting of rectal cancer. Data on type of article, citation, and key criteria will be extracted and tabula...
Ngày tải lên: 11/08/2014, 05:21
Báo cáo y học: " Is Ankyrin a genetic risk factor for psychiatric phenotypes?" pot
... here: http://www.biomedcentral.com/1471-244X/11/103/prepub doi:10.1186/1471-244X-11-103 Cite this article as: Gella et al.: Is Ankyrin a genetic risk factor for psychiatric phenotypes? BMC Psychiatry 2011 11:103. Submit your next manuscript to BioMed Central and take full advantage ... RESEARC H ARTIC LE Open Access Is Ankyrin a genetic risk factor for psychiatr...
Ngày tải lên: 11/08/2014, 15:22
Báo cáo y học: " Respiratory Research: a new multidisciplinary journal for a new age " doc
... Jeffery Drazen of Harvard University, who was the North American Editor-in-Chief during the early stages when Respiratory Research was being set up. He played a very active and enthusiastic role ... text of primary articles. The full text of all primary research articles will, therefore, be widely available online free of charge, ensuring that all research findings are easily accessible t...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo y học: " Identification of a high incidence region for retroviral vector integration near exon 1 of the LMO2 locus" pot
... locus Koichiro Yamada 1 , Tomonori Tsukahara 1 , Kazuhisa Yoshino 1 , Katsuhiko Kojima 1 , Hideyuki Agawa 1 , Yuki Yamashita 1 , Yuji Amano 1 , Mariko Hatta 1 , Yasunori Matsuzaki 1 , Naoki Kurotori 1 , ... http://www.retrovirology.com/content/6 /1/ 79 Page 9 of 9 (page number not for citation purposes) 11 . Tsukahara T, Agawa H, Matsumoto S, Matsuda M, Ueno S, Yama...
Ngày tải lên: 12/08/2014, 23:22
Báo cáo y học: " Identification of a novel motif responsible for the distinctive transforming activity of human T-cell leukemia virus (HTLV) type 1 Tax1 protein from HTLV-2 Tax2" pps
... anti -Tax1 anti- The Tax1 (18 5-207) region negatively regulates the transforming activity of Tax1Figure 7 The Tax1 (18 5-207) region negatively regulates the transforming activity of Tax1. (A) The amino ... T-cell leukemia virus (HTLV) type 1 Tax1 protein from HTLV-2 Tax2 Toshiyuki Shoji 1, 2 , Masaya Higuchi 1 , Rie Kondo 1 , Masahiko T...
Ngày tải lên: 12/08/2014, 23:22
Báo cáo y học: " MDM2 is a novel E3 ligase for HIV-1 Vif" pot
... Shogoin-Kawaracho, Sakyo-ku, Kyoto 606-8507, Japan, 7 Central Pharmaceutical Research Institute, Japan Tobacco Inc., 1-1 Murasaki-cho, Takatsuki, Osaka 569-1125, Japan, 8 Laboratory of Disease ... Hirofumi Akari 8 , Yoshio Koyanagi 9 , Jun Fujita 3 and Takashi Uchiyama 1 Address: 1 Department of Hematology and Oncology, Graduate School of Medicine, Kyoto University, 54 Shogoin-Kawaracho...
Ngày tải lên: 13/08/2014, 05:21
Báo cáo y học: " ''''Libyan Trial'''': a verdict running counter to scientific evidence" ppt
Ngày tải lên: 13/08/2014, 09:20
Báo cáo y học: "Sequence homology: A poor predictive value for profilins cross-reactivity" ppt
... purposes) Clinical and Molecular Allergy Open Access Research Sequence homology: A poor predictive value for profilins cross-reactivity Mojtaba Sankian 1 , Abdolreza Varasteh* 1 , Nazanin Pazouki 1 and Mahmoud ... Institute, Mashhad, Iran Email: Mojtaba Sankian - m_sankian@hotmail.com; Abdolreza Varasteh* - a- varasteh@mums.ac.ir; Nazanin Pazouki - npazouki@hotmail.com; Mah...
Ngày tải lên: 13/08/2014, 13:22
Báo cáo y học: "Introduction of a pyramid guiding process for general musculoskeletal physical rehabilitation" pot
... phases of inflammation con- trol and that, based on objective data, they are a good can- didate for non-surgical care, including physical rehabilitation. The proposed physical rehabilitation Pyramid Explanation ... tier may re-enforce this poor engram [9]. Additionally, tissues that are in an unwanted shortened state may affect the static and dynamic proprioception and engram of...
Ngày tải lên: 13/08/2014, 14:20
Báo cáo y học: "Psychosocial factors and their predictive value in chiropractic patients with low back pain: a prospective inception cohort study" docx
... Karjalainen K, Malmivaara A, van Tulder M, Roine R, Jauhiainen M, Hurri H, Koes B, Cochrane : Multidisciplinary biopsychosocial rehabilitation for subacute low back pain in working-age adults: a ... episode, chronicity, aggravating features and bothersomeness using Deyo's 'Core Set'. Psychological factors (fear-avoidance beliefs, inevitability, anxiety/distress an...
Ngày tải lên: 13/08/2014, 14:20