Báo cáo sinh học: " GRISOTTO: A greedy approach to improve combinatorial algorithms for motif discovery with prior knowledge" ppt

Báo cáo sinh học: " GRISOTTO: A greedy approach to improve combinatorial algorithms for motif discovery with prior knowledge" ppt

Báo cáo sinh học: " GRISOTTO: A greedy approach to improve combinatorial algorithms for motif discovery with prior knowledge" ppt

... RISOTTO combinatorial algorithm [24] in a greedy fa shion to take into account prior information in a PSP format. RISOTTO is a con- sensus-based algorithm that exhaus tively enumerates all motifs ... single and combined priors in finding motifs in yeast ChiP-chip data. This data is now a gold standard with several priors available, providing an unbiased experimental assay f...

Ngày tải lên: 12/08/2014, 17:20

13 287 0
Báo cáo sinh học: "Q&A: Quantitative approaches to planar polarity and tissue organization" pot

Báo cáo sinh học: "Q&A: Quantitative approaches to planar polarity and tissue organization" pot

... Drosophila. Question & Answer Q& ;A: Quantitative approaches to planar polarity and tissue organization Emily Marcinkevicius, Rodrigo Fernandez-Gonzalez and Jennifer A Zallen Address: Howard ... Epithelia display two types of polarity: apical-basal polarity and planar cell polarity (PCP; also called tissue polarity). Apical-basal polarity refers to the asymmetry of epithelial...

Ngày tải lên: 06/08/2014, 19:21

5 384 0
Báo cáo sinh học: "CHSMiner: a GUI tool to identify chromosomal homologous segments" pot

Báo cáo sinh học: "CHSMiner: a GUI tool to identify chromosomal homologous segments" pot

... the maximal gap size (number of unmatched genes) allowed between two adjacent matched genes (Figure 1). Another advantage of the algorithm is that the greedy search has a fast computa- tional speed ... Shanghai Jiao Tong University, Shanghai 200240, PR China and 4 Shanghai Centre for Bioinformation Technology, 100 Qinzhou Road, Shanghai 200235, PR China Email: Zhen Wang - zwang01@sib...

Ngày tải lên: 12/08/2014, 17:20

7 273 0
Báo cáo sinh học: "An image processing approach to computing distances between RNA secondary structures dot plots" ppsx

Báo cáo sinh học: "An image processing approach to computing distances between RNA secondary structures dot plots" ppsx

... CUCGUGAAUAUAACACUCAAG- AUUCAAAAAAAACAAAUCAAA- GACCGAAAUUUAUGUUUAGUGA AAAAGAAAAGUUUUUUUUAGAA 5 (((( ((( (( ((((( ))))) )) ))))))) 46 GGUUCAGUUCAUUGCUCAUACUU- UAUGUUAUCAAUUGUUGGCAUGC- AACGGUAUUCUCGUACGACAACC ... ACCGCCAGACAGGGCCAAGCCA- UCCAAAUUCAUAGUAUAAUACA- CAUCCUAAGGAAAAGAAAAAGGA CAUCCUAAGGAAAAGAAAAAGGA 2 (((.((.((( (((((((( ))))))))))) )).))) 47 GCUGUAGCCAAGUGGUAGUUGCU- GCGUUCCGUCAGACUCAUGA...

Ngày tải lên: 12/08/2014, 17:20

19 247 0
Báo cáo sinh học: "An automated stochastic approach to the identification of the protein specificity determinants and functional subfamilies" pot

Báo cáo sinh học: "An automated stochastic approach to the identification of the protein specificity determinants and functional subfamilies" pot

... 2005, 33(14):4455-4465. doi:10.1186/1748-7188-5-29 Cite this article as: Mazin et al.: An au tomated stochastic approach to the identification of the protein specificity determinants and functiona l subfamilies. Algorithms for Molecular Biology ... techniques that go beyond standard annotation approaches, i.e. annotation by close homolog and homology-based family identifica- tion. The...

Ngày tải lên: 12/08/2014, 17:20

12 447 0
Báo cáo khoa học: "SITS: A Hierarchical Nonparametric Model using Speaker Identity for Topic Segmentation in Multiparty Conversations" pptx

Báo cáo khoa học: "SITS: A Hierarchical Nonparametric Model using Speaker Identity for Topic Segmentation in Multiparty Conversations" pptx

... a segment-specific topic, each segment-specific topic to a conversational topic and each conversational topic to a shared topic. For efficiency, we make use of the minimal path assumption (Wallach, 2008) to generate ... scientists. Associating each speaker with a scalar that mod- els their tendency to change the topic does improve performance on standard tasks, but it’s ina...

Ngày tải lên: 07/03/2014, 18:20

10 559 0
báo cáo sinh học:" Empowering primary care workers to improve health services: results from Mozambique''''s leadership and management development program" docx

báo cáo sinh học:" Empowering primary care workers to improve health services: results from Mozambique''''s leadership and management development program" docx

... health challenges. Participants learned to use management and leadership tools such as the Leading and Managing Framework, gap analysis, a pri- ority matrix, the SMART Objectives Tool, an action ... patients and staff to see. MOH workers in Nampula are realistic when they speak about Mozambique's substantial health challenges. But they also report that the Challenges Program appro...

Ngày tải lên: 18/06/2014, 17:20

3 343 0
báo cáo sinh học:" Training health care workers to promote HIV services for patients with tuberculosis in the Democratic Republic of Congo" pptx

báo cáo sinh học:" Training health care workers to promote HIV services for patients with tuberculosis in the Democratic Republic of Congo" pptx

... Kokolomani, National AIDS Program, for their support. The authors also thank Martine Tabala, Felicien Llenda, Richard Mangala, Willy Atungi, Lisette Kapinga, Adele Mumpassi, and Eugenie Mugoyo. Without ... integrate HIV activities into routine care for patients with TB. A participatory approach resulted in training materials that fulfilled local needs. Published: 17 March 2009 Hu...

Ngày tải lên: 18/06/2014, 17:20

9 650 0
Báo cáo sinh học: " Convergence of the modified Mann''''s iterative method for asymptotically kappa-strictly pseudocontractive mappings" pptx

Báo cáo sinh học: " Convergence of the modified Mann''''s iterative method for asymptotically kappa-strictly pseudocontractive mappings" pptx

... errors for asymptotically nonexpansive map- pings. Comput. Math. Appl. 37, 1–7 (1999) [12] Takahashi, W: Nonlinear Functional Analysis: Fixed Point Theory and Its Applications. Yokohama Publishers, ... versions will be made available soon. Convergence of the modified Mann's iterative method for asymptotically kappa-strictly pseudocontractive mappings Fixed Point Theory and Applicatio...

Ngày tải lên: 18/06/2014, 22:20

14 309 0
Báo cáo sinh học: " Comparison of real-time PCR and hemagglutination assay for quantitation of human polyomavirus JC" pptx

Báo cáo sinh học: " Comparison of real-time PCR and hemagglutination assay for quantitation of human polyomavirus JC" pptx

... viral loadFigure 1 A – C: Analysis of HA and quantitative real-time PCR data employed for the determination of JC viral load. JCV (Mad1), propagated in Dr. Walker's laboratory (I) or propagated ... model. Real-time PCR detects as low as 0.001 HAU equivalent of JCV, eliminates the variability traditionally associated with the HA assay, and thus could reliably replace the HA assay e...

Ngày tải lên: 19/06/2014, 08:20

5 359 0
w