Báo cáo sinh học: " Jane: a new tool for the cophylogeny reconstruction problem" ppt

Báo cáo sinh học: " Jane: a new tool for the cophylogeny reconstruction problem" ppt

Báo cáo sinh học: " Jane: a new tool for the cophylogeny reconstruction problem" ppt

... version of Jane. Values of the se parameters were systematically evaluated and the best values found are used as defaults. Jane can import its files in either Tarzan or a Nexus- based format. A file ... implementation of a new software tool, called Jane, for the study of historical associations. This problem arises in parasitology (associations of hosts and parasites), molecu...

Ngày tải lên: 12/08/2014, 17:20

10 553 0
báo cáo khoa học: " NorthStar, a support tool for the design and evaluation of quality improvement interventions in healthcare" ppt

báo cáo khoa học: " NorthStar, a support tool for the design and evaluation of quality improvement interventions in healthcare" ppt

... Broussais – Hôtel Dieu, Paris. Partner manager – Pierrre Durieux Italy: Unit of Clinical Governance, Agenzia Sanitaria Regionale (Regional Health Care Agency) of Emilia-Romagna, Bologna. Partner manager ... manager – Roberto Grilli Italy: Center for the Evaluation of Effectiveness of Health Care (Ce.V.E .A. S.), Modena. Partner manager – Alessandro Liberati The Netherlands: Centre for...

Ngày tải lên: 11/08/2014, 05:22

7 429 0
Báo cáo sinh học: "CHSMiner: a GUI tool to identify chromosomal homologous segments" pot

Báo cáo sinh học: "CHSMiner: a GUI tool to identify chromosomal homologous segments" pot

... is the maximal gap size (number of unmatched genes) allowed between two adjacent matched genes (Figure 1). Another advantage of the algorithm is that the greedy search has a fast computa- tional ... and randomly ordered genomes. When the size of the CHS m is fixed, the smaller the maximal gap size is, the harder it can be observed. Therefore, the value can be treated as t...

Ngày tải lên: 12/08/2014, 17:20

7 271 0
Báo cáo khoa học: TICL – a web tool for network-based interpretation of compound lists inferred by high-throughput metabolomics doc

Báo cáo khoa học: TICL – a web tool for network-based interpretation of compound lists inferred by high-throughput metabolomics doc

... be obtained from the KEGG atlas. However, without quantitative analysis, there are no clues about the quality of these relations. To fill the gap, we propose an analytical framework for the interpretation ... that share the same compounds. In general, a reaction consists of multiple reactant pairs, and the one that appears in a KEGG metabolic pathway is called a main pair....

Ngày tải lên: 16/03/2014, 01:20

11 402 0
Báo cáo sinh học: "On a multivariate implementation of the Gibbs sampler" pps

Báo cáo sinh học: "On a multivariate implementation of the Gibbs sampler" pps

... either the scalar or block sampling strategies was compared on the basis of the simple estimator of the mean of marginal posterior distributions (the raw average of the elements ... Alternatively, when the integral has a closed-form solution, the mixture estimator can take the form The Monte-Carlo variances of the mixture estimator...

Ngày tải lên: 09/08/2014, 18:22

6 320 0
Báo cáo sinh học: "iTriplet, a rule-based nucleic acid sequence motif finder" pptx

Báo cáo sinh học: "iTriplet, a rule-based nucleic acid sequence motif finder" pptx

... techniques, large amounts of sequencing data are readily available for analysis. Natural biological signals are intrinsically highly variable making their complete identification a computationally challenging ... promoter+5' UTR Remarks iTriplet CCATATTAGGACATCTGCGT <20,1> model PMSprune CCA AATTTG Ref. [17] MITRA CCATATTAGGACA Ref. [14] Published CAGGATGTCCATATTAGGACATC Transf...

Ngày tải lên: 12/08/2014, 17:20

14 264 0
Báo cáo y học: " L2L: a simple tool for discovering the hidden significance in microarray expression data" pdf

Báo cáo y học: " L2L: a simple tool for discovering the hidden significance in microarray expression data" pdf

... generates easy-to-navigate, annotated HTML pages as output. (a) The L2L web interface. (b) The Results summary page displays each list from the database that significantly matched the data, along ... the GNU General Public License. L2L Microarray Database The need for a standardized format for presenting and storing microarray data from disparate platforms has been recog- n...

Ngày tải lên: 14/08/2014, 14:22

18 289 0
Báo cáo sinh học: " Vanishing heat conductivity limit for the 2D Cahn-Hilliard-Boussinesq system" ppt

Báo cáo sinh học: " Vanishing heat conductivity limit for the 2D Cahn-Hilliard-Boussinesq system" ppt

... Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Vanishing heat conductivity limit for the ... Jishan Fan 2 1 Department of Mathematics, Zhejiang Normal University, Jinhua 321004, People’s Republic of China 2 Department of Applied Mathematics, Nanjing Forestry University, Nanjing 210...

Ngày tải lên: 18/06/2014, 22:20

9 252 0
Báo cáo sinh học: " An advanced Bayesian model for the visual tracking of multiple interacting objects" pptx

Báo cáo sinh học: " An advanced Bayesian model for the visual tracking of multiple interacting objects" pptx

... 5 [18], a variance reduction technique called Rao–Blackwellization has been used to improve the accuracy. A random finite set (RFS) approach can be used as an alternative to data association methods, ... and therefore with an analytical expression known as the Kalman filter. This assumption arises from the fact that the object dynamics can be accept- ably simulated by a constant v...

Ngày tải lên: 18/06/2014, 22:20

38 395 0
Báo cáo sinh học: " Shell Vial culture Assay for the rapid diagnosis of Japanese encephalitis, West Nile and Dengue-2 viral encephalitis" pdf

Báo cáo sinh học: " Shell Vial culture Assay for the rapid diagnosis of Japanese encephalitis, West Nile and Dengue-2 viral encephalitis" pdf

... Research, Pondicherry – 605 006, India Email: Rangaiah S Jayakeerthi* - srjkeerthi@yahoo.com; Raghava V Potula - raghava@potula.net; S Srinivasan - srinivasan@jipmer.edu; S Badrinath - sbadrinath@rediffmail.com * ... Japanese encephalitis, West Nile and Dengue-2 viral encephalitis Rangaiah S Jayakeerthi* 1 , Raghava V Potula 1 , S Srinivasan 2 and S Badrinath 1 Address: 1 Department of Mi...

Ngày tải lên: 19/06/2014, 08:20

7 455 0
w