báo cáo khoa học: " The Reinforcing Therapist Performance (RTP) experiment: Study protocol for a cluster randomized trial" ppsx

báo cáo khoa học: " The Reinforcing Therapist Performance (RTP) experiment: Study protocol for a cluster randomized trial" ppsx

báo cáo khoa học: " The Reinforcing Therapist Performance (RTP) experiment: Study protocol for a cluster randomized trial" ppsx

... therapists; average therapist age; percentage of Caucasian thera- pists; percenta ge of male therapists; and AAFT staff rat- ings of expected performance. This last measure was used to take into account any ... current paper describes the design and baseline characteristics of the therapists participating in the Rein- forcing Therapist Performance (RTP) study, which is a...

Ngày tải lên: 11/08/2014, 16:20

12 262 0
Báo cáo y học: "The Reinforcing Therapist Performance (RTP) experiment: Study protocol for a cluster randomized trial" potx

Báo cáo y học: "The Reinforcing Therapist Performance (RTP) experiment: Study protocol for a cluster randomized trial" potx

... percentage of male clients; number of therapists; average therapist age; percentage of Caucasian thera- pists; percenta ge of male therapists; and AAFT staff rat- ings of expected performance. ... this article as: Garner et al.: The Reinforcing Therapist Performance (RTP) experiment: Study protocol for a cluster randomized trial. Implementation Science 2010 5:5. S...

Ngày tải lên: 11/08/2014, 05:21

12 224 0
báo cáo khoa học: " The buccal minor salivary glands as starting point for a metastasizing adenocarcinoma – report of a case" pptx

báo cáo khoa học: " The buccal minor salivary glands as starting point for a metastasizing adenocarcinoma – report of a case" pptx

... leiomy- osarcoma, lipoma, liposarcoma, neurofibroma, schwan- noma, malignant peripheral nerve sheath tumour, hemangioma, angiosarcoma) and from salivary glands (pleomorphic adenoma, adenoid cystic carcinoma ... although the hard palate and the gin- giva are the most common intraoral sites of occurrence [10]. Oral metastatic lesions can also be the initial appear- ance of undiagnosed p...

Ngày tải lên: 11/08/2014, 20:20

5 339 0
Báo cáo y học: " Relatives Education And Coping Toolkit - REACT. Study protocol of a randomised controlled trial to assess the feasibility and effectiveness of a supported self management package for relatives of people with recent onset psychosis" pdf

Báo cáo y học: " Relatives Education And Coping Toolkit - REACT. Study protocol of a randomised controlled trial to assess the feasibility and effectiveness of a supported self management package for relatives of people with recent onset psychosis" pdf

... be addressed before a large scale clinical and cost effectiveness evaluation of this approach. Specifically, the trial will provide extensive quantitative and qualitative data on the acceptability ... contact with a professional/paraprofessional, and a CBT (Cognitive Behaviour Therapy) rather than educational model [10]. Self-man agement approaches can increase dissemination of evid...

Ngày tải lên: 11/08/2014, 15:22

7 310 0
báo cáo khoa học: " Evaluating the effectiveness of a tailored multifaceted performance feedback intervention to improve the quality of care: protocol for a cluster randomized trial in intensive care" pps

báo cáo khoa học: " Evaluating the effectiveness of a tailored multifaceted performance feedback intervention to improve the quality of care: protocol for a cluster randomized trial in intensive care" pps

... addition, they will be sent similar, but separate, basic quarterly and annual feed- back reports containing data on the extended in dicator set. Also, support by the NICE data managers is available and ... combine manual entry of data using dedicated software with automated data extractions from electronic patient records available in, e.g.,theirpatient data management system. Each month,...

Ngày tải lên: 10/08/2014, 11:20

10 422 0
Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"

Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"

... analysis of the study. MS conceived and coordinated the study and was involved in the interpretation of the data and manuscript revi- sion. All authors read and approved the final manuscript. Acknowledgements All ... and are not related to the presence of abnormalities on the CXR. Unfortunately, these abnormalities formed a sub- stantial part of all new and unexpected abnor...

Ngày tải lên: 25/10/2012, 10:39

7 724 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3. Acknowledgement This project was supported by grants from the Aus- trian Science ... ACTIN2 gene as an internal standard. PCRs were performed using the following primers: ACT2 (At3g18780): 5-ACATTGT GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (...

Ngày tải lên: 14/02/2014, 19:20

11 701 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

... Forward (nt 1552–1585 PAI-2) SJS260 AACTCACCAT AGGAATGCATAATAAATAACAAAG Reverse (nt 1585–1552 PAI-2) SJS261 CTTTGTTA AAGCTTATGCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2) SJS262 AACTCACCAT AGGAATGCATAAGCTTTAACAAAG ... 1491–1508 PAI-2) SJS138 TACG AGATCT TAGCTACATTAAATAGGC Reverse (nt 1620–1603 PAI-2) SJS172 GGGATCATGCCCA AGCTTATTTTCCTTACT Forward (nt 1491–1520 PAI-2) SJS173 AGTAAGGAAAATA AG...

Ngày tải lên: 16/02/2014, 09:20

14 636 0
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

... 5¢-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3¢; reverse primer, 5¢-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3¢). The PCR product was purified, treated with T4 exonuclease to create vector-compatible overhangs and annealed ... FEBS containing 100 lm of (GlcNAc) 1–4 was analysed at the start, in the middle and at the end of each series of sam- ples. The resulting average values of the sta...

Ngày tải lên: 18/02/2014, 08:20

14 684 0
Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf

Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf

... 88, 12–19. 19 Ohtani N, Yanagawa H, Tomita M & Itaya M (2004) Identification of the first archaeal type 1 RNase H gene from Halobacterium sp. NRC-1: archaeal RNase HI can cleave an RNA-DNA junction. ... chromosomal DNA during mammalian Okazaki fragment processing. J Biol Chem 272, 22591–22599. 9 Haruki M, Tsunaka Y, Morikawa M & Kanaya S (2002) Cleavage of a DNA-RNA-DNA ⁄ DNA chimer...

Ngày tải lên: 19/02/2014, 18:20

10 565 1
w