Báo cáo sinh học: " A Bayesian analysis of mixed survival modelst" pptx

Báo cáo sinh học: " A Bayesian analysis of mixed survival modelst" pptx

Báo cáo sinh học: " A Bayesian analysis of mixed survival modelst" pptx

... quality of the approximation when the Laplacian integration was used. However, because the amount of information available to estimate a rather small sire variance was ... Time-dependent association mea- sures for bivariate survival analysis. J Am Stat Ass 87, 641-650 Berger JO (1985) Statistical Decision Theory and Bayesian Analysis. Springle...

Ngày tải lên: 09/08/2014, 18:22

25 230 0
Báo cáo sinh học: "A quantitative analysis of the mechanism that controls body size in Manduca sexta" docx

Báo cáo sinh học: "A quantitative analysis of the mechanism that controls body size in Manduca sexta" docx

... That is, the final mass of each is a constant multi- ple of the final mass of the previous instar. As a conse- quence, the mass of a larva at each larval molt increases exponentially from instar ... depicted as a volume within the parame- ter space of Figure 15 and the gradient along each parameter axis can be calculated. Given a specific assumption about the nature of g...

Ngày tải lên: 06/08/2014, 18:21

15 357 0
Báo cáo sinh học: "A global analysis of genetic interactions in Caenorhabditis elegans" doc

Báo cáo sinh học: "A global analysis of genetic interactions in Caenorhabditis elegans" doc

... different. Additional data files Additional data are available with this paper online. Additional data file 1 is a table listing average growth scores for each query-target pair tested in the SGI analysis. Additional ... same level of the pathway or are ancillary components at different levels of the pathway may reveal a ‘within-pathway’ interaction. Finally, each gene of an inter...

Ngày tải lên: 06/08/2014, 18:21

27 399 0
Báo cáo y học: "A comparative analysis of antibody repertoire against Staphylococcus aureus antigens in Patients with Deep-Seated versus Superficial staphylococcal Infections"

Báo cáo y học: "A comparative analysis of antibody repertoire against Staphylococcus aureus antigens in Patients with Deep-Seated versus Superficial staphylococcal Infections"

... Publisher. All rights reserved Research paper A comparative analysis of antibody repertoire against Staphylococcus aureus antigens in Patients with Deep-Seated versus Superficial staphylococcal Infections ... commercially available PG and TA 3.6 Correlation coefficients We analyzed the correlation of levels of anti- peptidoglycan and teichoic acid antibodies in sera from patie...

Ngày tải lên: 02/11/2012, 11:08

8 526 2
Tài liệu Báo cáo khoa học: "A Statistical Analysis of Morphemes in Japanese Terminology" docx

Tài liệu Báo cáo khoa học: "A Statistical Analysis of Morphemes in Japanese Terminology" docx

... E-Mail: kyo@rd.nacsis.ac.jp Abstract In this paper I will report the result of a quan- titative analysis of the dynamics of the con- stituent elements of Japanese terminology. In Japanese ... zone, values of statistical measures such as type-token ratio, the parameters of 'laws' (e.g. of Mandel- brot, 1962) of word frequency distributions, etc. change s...

Ngày tải lên: 20/02/2014, 18:20

7 596 0
Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

... the antiproliferative capacity of WP631 (measured as IC 50 after a 72-h continuous treatment) was greater than that of daunorubicin. The propensities of daunorubicin and WP631 to promote apoptosis ... phase contrast and fluorescence photo- graphs of selected field of cells obtained under the same magnification and contrast acquisition characteristics, and using the autofluorescence o...

Ngày tải lên: 20/02/2014, 23:20

7 583 0
Báo cáo khoa học: "A Computational Analysis of Complex Noun Phrase in Messages" docx

Báo cáo khoa học: "A Computational Analysis of Complex Noun Phrase in Messages" docx

... eztend/retraet can be analyzed as a modifier of cycle, a process word. Fuze setter, a part name, can be treated as a unit because noun sequences consisting of part names are generally local in nature. ... ). In addition, it can be a repair action (alignment, repair), an assistance actions ( assistance ), and so on. Only modifiers with appropriate semantic and syntactic ca...

Ngày tải lên: 08/03/2014, 18:20

4 520 0
Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx

Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx

... (kid A5 5G) PA55G(+) GACACCGCAAAGCCGCCAGTGCGGGCAAA Change GGC–GCC in A5 5 (kid A5 5G) PT69G()) TTGGCATACGTACCACAGGTGTTGTAC Change ACA–GGA in T69 (kid T69G) PT69G(+) GTACAACACCTCCGGTACGTATGCCAA Change ... TTGTACGTTGCGAACAACCCCGGACAAT Change GAT–GAA in D75 (kid D75E) PD75E(+) ATTGTCCGGGGTTGTTCGCAACGTACAA Change ATC–TTC in D75 (kid D75E) PD75N()) TTGTACGTTGCAATCAACCCCGGACAAT Change GAT–AAT in...

Ngày tải lên: 16/03/2014, 03:20

14 481 0
Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

... deoxyribonuclease (DNase I, amplification grade; TaKaRa, Kyoto, Japan). Microarray analysis and data mining (Aligent array) A one-color microarray-based gene expression analysis sys- tem (Agilent Technologies, ... This analysis of microarray data revealed a striking similar- ity of gene clusters among AT-MSC-Hepa, primary hepatocytes and human liver. This indicates that AT-MSC-He...

Ngày tải lên: 30/03/2014, 04:20

14 600 0
Báo cáo khoa học: "A Quantitative Analysis of Lexical Differences Between Genders in Telephone Conversations" pot

Báo cáo khoa học: "A Quantitative Analysis of Lexical Differences Between Genders in Telephone Conversations" pot

... convergence of male and female linguistic patterns in cross-gender con- versations was observed. An analysis of the fea- tures revealed that the most characteristic features for males are swear words ... dude is analyzed as a male-to-male indicator. In our work, the word dude emerged as a male feature. As another ex- ample, our observation that some acknowledgments and backchannels...

Ngày tải lên: 31/03/2014, 03:20

8 354 0
w