Báo cáo sinh học: "On a multivariate implementation of the Gibbs sampler" pps

Báo cáo sinh học: "On a multivariate implementation of the Gibbs sampler" pps

Báo cáo sinh học: "On a multivariate implementation of the Gibbs sampler" pps

... either the scalar or block sampling strategies was compared on the basis of the simple estimator of the mean of marginal posterior distributions (the raw average of the elements ... strategy is compared with the traditional scalar implementation of the Gibbs sampler. A data file based on a univariate animal model with 250 ind...

Ngày tải lên: 09/08/2014, 18:22

6 320 0
Báo cáo sinh học: "Parasite immunomodulation and polymorphisms of the immune system" ppsx

Báo cáo sinh học: "Parasite immunomodulation and polymorphisms of the immune system" ppsx

... similarly, non-coding variants of the transcriptional regulator STAT-6, which is on the IL-4 pathway, are associated with higher asthma incidence and decreased susceptibility to the roundworm Ascaris ... levels rather than variations in amino acid sequence in structural domains (Figure 2). Leishmania mexicana Candida albicans Heligmosomoides polygyrus Ixodes hexagonus Protozoa Un...

Ngày tải lên: 06/08/2014, 19:20

4 389 1
Báo cáo sinh học: " Periostin: a promising target of therapeutical intervention for prostate cancer" potx

Báo cáo sinh học: " Periostin: a promising target of therapeutical intervention for prostate cancer" potx

... as follows: Periostin (forward, 5’ AGGCAAACAG CTCAGAGTCTTCGT 3’ and reverse, 5’ TGCAGCTTCAAGTAGGCTGAGGAA 3’ ). b-actin (forward, 5’ CTGGCACCACACCTTCTA- CAATGA 3’ and reverse, 5’ TTAATGTCACGCAC- GATTTCCCGC ... growth of colon cancer by augmenting cell survival via the Akt/PKB pathway. Cancer Cell 2004, 5:329-339. 16. Kudo Y, Ogawa I, Kitajima S, Kitagawa M, Kawai H, Gaffney PM, Miyauchi M,...

Ngày tải lên: 18/06/2014, 19:20

10 368 0
Báo cáo sinh học: "Electroporation increases antitumoral efficacy of the bcl-2 antisense G3139 and chemotherapy in a human melanoma xenograft" pot

Báo cáo sinh học: "Electroporation increases antitumoral efficacy of the bcl-2 antisense G3139 and chemotherapy in a human melanoma xenograft" pot

... dehydrogenase (GAPDH) genes. The following primers were used: bcl-2 forward 5’ -GTGAACTGGGGGAGG ATTGT-3’ and reverse 5’-GGAGAAATCAAACAGAGGCC-3’ ; GAPDH forward 5’-CCAAGGTCATCCATGACAAC-3’ and reverse ... therapies of metastatic melanoma have been unrewarding with a median survi- val of 6 to 7.5 months and a 5 year survival of 6% [41]. Treatment options include chemotherapy with dac...

Ngày tải lên: 18/06/2014, 22:20

10 484 0
Báo cáo sinh học : "Q&A: Genetic analysis of quantitative traits" pdf

Báo cáo sinh học : "Q&A: Genetic analysis of quantitative traits" pdf

... http://jbiol.com/content/8/3/23 Journal of Biology 2009, 88:: 23 Question & Answer QQ&&AA:: GGeenneettiicc aannaallyyssiiss ooff qquuaannttiittaattiivvee ttrraaiittss Trudy FC Mackay WWhhaatt aarree qquuaannttiittaattiivvee ... aassssoocciiaattiioonn mmaappppiinngg?? Both methods have advantages and disadvantages. Linkage mapping, particularly in controlled crosses (as opposed...

Ngày tải lên: 06/08/2014, 19:20

5 363 0
Báo cáo toán học: "On a Strange Recursion of Golomb" ppsx

Báo cáo toán học: "On a Strange Recursion of Golomb" ppsx

... have all n non-terminal symbols, we give a combinatorial interpretation for the transformation L (r) w . After the application of L (r) w to A, the last step is the placement of r + 1 copies of the ... partial information about the formulation of a bijective proof. The paper is organized as follows. In Section 2, we define a few classical symmetric functions, and s...

Ngày tải lên: 07/08/2014, 06:20

15 297 0
Báo cáo toán học: "On a Strange Recursion of Golomb" pptx

Báo cáo toán học: "On a Strange Recursion of Golomb" pptx

... Mathematics Department of Mathematics University of Toronto University of Toronto Toronto, Canada M5S 1A1 Toronto, Canada M5S 1A1 barbeau@math.utoronto.ca tanny@math.utoronto.ca Submitted: January 4, ... values of the descendant sequence of 1. Golomb’s conjecture amounts to the assertion that, in the case B =1,foreachpositive integer k,thereisanunique way of assigning the...

Ngày tải lên: 07/08/2014, 06:20

9 304 0
Báo cáo toán học: "On a combinatorial problem of Asmus Schmidt" pps

Báo cáo toán học: "On a combinatorial problem of Asmus Schmidt" pps

... several suggestions that allowed me to improve the text of the paper. This work was done during a long-term visit at the Mathemat- ical Institute of Cologne University. I thank the staff of the ... 8 a multiple generalization of Whipple’s transformation (8). The required generalization is given by G. E. Andrews in [1], Theorem 4. After making the passage q → 1 in Andr...

Ngày tải lên: 07/08/2014, 08:20

8 348 0
Báo cáo toán học: " On a Partition Function of Richard Stanley" pptx

Báo cáo toán học: " On a Partition Function of Richard Stanley" pptx

... questions. 2 The Main Theorem We begin with some preliminaries about partitions and their conjugates. For a given partition π with parts each  N,wedenotebyf i (π) the number of appearances of i as a part ... in the following be dealing with partitions whose parts are all  some given N.Welet¯π be that partition made up of the parts of π that are <N. In light of (11)...

Ngày tải lên: 07/08/2014, 08:22

10 269 0
Báo cáo toán học: " On a Balanced Property of Derangements" pptx

Báo cáo toán học: " On a Balanced Property of Derangements" pptx

... permutations and derangements hold for a- derangements as well. The only part of the argument that needs extra explanation is the analogue of Lemma 2.1 for a- derangements. the electronic journal of combinatorics ... results on the number of descents, and [4] for some results on the number of excedances. Finally, a- derangements are a special case of a class of...

Ngày tải lên: 07/08/2014, 13:21

14 221 0
w