Báo cáo y học: "Human palatine tonsil: a new potential tissue source of multipotent mesenchymal progenitor cells" pdf

Báo cáo y học: "Human palatine tonsil: a new potential tissue source of multipotent mesenchymal progenitor cells" pdf

Báo cáo y học: "Human palatine tonsil: a new potential tissue source of multipotent mesenchymal progenitor cells" pdf

... Sense: GGAAACTTTGCTGCCCAGATG 710–876 167 Antisense: TCACCAGGTTCACCAGGATTGC AGN, aggrecan; ALP, alkaline phosphatase; COL 2A1 , collagen type II α1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; ... 4 Research article Human palatine tonsil: a new potential tissue source of multipotent mesenchymal progenitor cells Sasa Janjanin 1,2 *, Farida Djouad 1 *, Rabie M Shanti 1...

Ngày tải lên: 09/08/2014, 10:23

12 359 0
Báo cáo Y học: Human sprouty 4, a new ras antagonist on 5q31, interacts with the dual specificity kinase TESK1 potx

Báo cáo Y học: Human sprouty 4, a new ras antagonist on 5q31, interacts with the dual specificity kinase TESK1 potx

... transcript (7 kb) harbors five polyadenylation sites (two AATAAA, and three AATTAAA), nine ATTTA sequences [23], two Alu-repeats and three CAGAC motifs [24]. BLAST searches revealed the homology ... post-translational phos- phorylation and palmitoylation [40]. Only a small subset of spry1 was recruited to the plasma membrane as part of lipid rafts upon cellular activation by VEGF, also c...

Ngày tải lên: 31/03/2014, 15:20

11 544 0
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

... quantitative and qualitative assays for b-galactosidase (activation of LacZ reporter gene). BD, pGBT9; BD*, pAS2-1; AD, pGAD424; AD**, pACT2. Activity values are given as mean values ± standard deviation ... protein -A Sepharose, washed and separated by SDS/PAGE. The immunostaining of Western blot was performed by commercially available, high affinity anti-(b-galactosidase) Ig. Anti-(b-gal...

Ngày tải lên: 21/02/2014, 15:20

10 466 0
Báo cáo Y học: Endogenous cardiac glycosides, a new class of steroid hormones pot

Báo cáo Y học: Endogenous cardiac glycosides, a new class of steroid hormones pot

... Masugi, F., Ogihara, T., Hasegawa, T., Sagakuchi, K. & Kuma- hara, Y. (1988) Normalization of high plasma level of ouabain- like immunoreactivity in primary aldosteronism after removal of adenoma. ... gland being a major place of synthesis and/or storage of ouabain, adrenalectomy leads to a lowering of ouabain plasma levels [18,29]. The adrenal cortex is likely to be the...

Ngày tải lên: 24/03/2014, 00:21

9 656 0
báo cáo hóa học:" Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures" potx

báo cáo hóa học:" Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures" potx

... minutes and photographed in a phase-contrast microscope (Ikaros System, Axiophot 2, Carl Zeiss, Jena, Germany) Flow Cytometry Analysis Flow cytometry analysis was performed using a Guava EasyCyte ... confirmed the mesenchymal nature of the isolated cells and their multipotency. Population doubling and karyotypic analysisFigure 2 Population doubling and karyotypic analysis. Panel A) R...

Ngày tải lên: 18/06/2014, 15:20

10 456 0
Báo cáo y học: "Preliminary evidence for a change in spectral sensitivity of the circadian system at night" potx

Báo cáo y học: "Preliminary evidence for a change in spectral sensitivity of the circadian system at night" potx

... Central Page 1 of 9 (page number not for citation purposes) Journal of Circadian Rhythms Open Access Research Preliminary evidence for a change in spectral sensitivity of the circadian system at ... to visual targets are apparently low- est just before dark and highest just before dawn [18]. Dacey et al. [19] have recently shown that in macaque (and, therefore, probably in humans as...

Ngày tải lên: 10/08/2014, 09:20

9 365 0
Báo cáo y học: " Automated ERCC1 immunochemistry on hybrid cytology/tissue microarray of malignant effusions: evaluation of antibodies 8F1 and D-10." potx

Báo cáo y học: " Automated ERCC1 immunochemistry on hybrid cytology/tissue microarray of malignant effusions: evaluation of antibodies 8F1 and D-10." potx

... generate software tools for automated analysis of TMA localization data and XLM-based standardized data capture and transfer [31]. As presented on F igure 2, our h ybrid C/TMAs are likely to be amenable ... ERCC1 immunochemistry on hybrid cytology /tissue microarray of malignant effusions: evaluation of antibodies 8F1 and D-10. Journal of Clinical Bioinformatics 2011 1:25. Soltermann...

Ngày tải lên: 10/08/2014, 09:22

10 330 0
Báo cáo Y học: Human immunoglobulin A (IgA)-specific ligands from combinatorial engineering of protein A ppt

Báo cáo Y học: Human immunoglobulin A (IgA)-specific ligands from combinatorial engineering of protein A ppt

... the interaction was sufficient for affinity chromatography and that the selectivity of the ligand was high. Affinity recovery of IgA from human plasma The potential use of the Z IgA1 affibody as affinity ligand ... specificity analysis of the Z IgA1 a body. Resulting overlay sensorgrams from separate injections of 0.2 l M solutions of human polyclonal IgA and IgA 1 ,humanmyelomaIgA 2...

Ngày tải lên: 08/03/2014, 23:20

9 585 0
Báo cáo Y học: Human bile salt-stimulated lipase has a high frequency of size variation due to a hypervariable region in exon 11 pot

Báo cáo Y học: Human bile salt-stimulated lipase has a high frequency of size variation due to a hypervariable region in exon 11 pot

... and fetal pancreas and in pancreatic tumoral cell lines [35,36]. FAPP and BSSL are structurally closely related, but are distinguished by a monoclonal antibody directed towards a fucosylated epitope, ... fresh human milk samples as previously described [31]. RNA hybridization was per- formed essentially as described in Sambrook et al.[32]. Approximately 20 lg of each RNA preparation was...

Ngày tải lên: 24/03/2014, 03:21

9 524 0
w