Báo cáo khoa học:Restricted walks in regular trees docx

Tài liệu Báo cáo khoa học: EGF receptor in relation to tumor development: molecular basis of responsiveness of cancer cells to EGFR-targeting tyrosine kinase inhibitors docx

Tài liệu Báo cáo khoa học: EGF receptor in relation to tumor development: molecular basis of responsiveness of cancer cells to EGFR-targeting tyrosine kinase inhibitors docx

... (2006) Lung adenocarcinomas induced in mice by mutant EGF receptors found in human lung cancers respond to a tyrosine kinase inhibitor or to down-regulation of the receptors. Genes Dev 20, 1496–1510. 5 ... Ito F (2009) Mito- gen-activated protein kinase phosphatase-1 modulated JNK activation is critical for apoptosis induced by inhibitor of epidermal growth factor recepto...

Ngày tải lên: 16/02/2014, 09:20

11 614 0
Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

... versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein Ilaria Sambi 1 , Pietro Gatti-Lafranconi 1 *, Sonia Longhi 2 and Marina Lotti 1 1 Dipartimento ... with a forward primer (5Â-TAC CTGGCCAATGAATATGCATCATCATCATCATCATA CTCCGTCGACCCCACC-3Â) designed to introduce a hexahistidine tag and a ClaI restrictio...

Ngày tải lên: 18/02/2014, 04:20

14 675 0
Tài liệu Báo cáo khoa học: Restricted localization of proline-rich membrane anchor (PRiMA) of globular form acetylcholinesterase at the neuromuscular junctions – contribution and expression from motor neurons doc

Tài liệu Báo cáo khoa học: Restricted localization of proline-rich membrane anchor (PRiMA) of globular form acetylcholinesterase at the neuromuscular junctions – contribution and expression from motor neurons doc

... 2009) doi:10.1111/j.1742-4658.2009.07022.x The expression and localization of the proline-rich membrane anchor (PRiMA), an anchoring protein of tetrameric globular form acetylcholines- terase (G 4 AChE), were studied at vertebrate neuromuscular ... localization of proline-rich membrane anchor (PRiMA) of globular form acetylcholinesterase a...

Ngày tải lên: 18/02/2014, 08:20

12 488 0
Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: regulation, molecular and cellular communication at the neurovascular interface pdf

Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: regulation, molecular and cellular communication at the neurovascular interface pdf

... are also interesting with regards to brain vas- culature, because they regulate the formation and main- tenance of BBB, modulate neurovascular coupling and maintain several parts of brain homeostasis. ... origin [78]. According to the monocyte hypothesis, during embryogenesis, and even in adults, migrating monocytes enter the brain via blood vessels and then differenti...

Ngày tải lên: 18/02/2014, 11:20

14 591 0
Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: therapeutic aspects of vascular endothelial growth factor doc

Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: therapeutic aspects of vascular endothelial growth factor doc

... VEGF-D, binds and activates this receptor, resulting in the proliferation and migration of lymph ECs and lymphangiogenesis [13]. Angiogenesis in brain diseases Brain stroke Stroke is induced through: ... among tissues in the body, and the risk of edema to brain functions should be carefully considered. Brain edema may increase pressure in the cranial cavity and...

Ngày tải lên: 18/02/2014, 11:20

8 573 0
Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: neurovascular injury and angiogenic recovery after stroke docx

Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: neurovascular injury and angiogenic recovery after stroke docx

... MINIREVIEW Brain angiogenesis in developmental and pathological processes: neurovascular injury and angiogenic recovery after stroke Ken Arai, Guang Jin, Deepti Navaratna and Eng H. ... whether neurovascular responses after stroke can be reinter- preted in the context of angiogenesis in the brain. Is it possible that some of the acute neurovascular...

Ngày tải lên: 18/02/2014, 11:20

9 708 0
Tài liệu Báo cáo khoa học: Catabolite repression in Escherichia coli – a comparison of modelling approaches docx

Tài liệu Báo cáo khoa học: Catabolite repression in Escherichia coli – a comparison of modelling approaches docx

... activates adenylate cyclase (CyaA) and leads to an increase in the intra- cellular cyclic AMP (cAMP) level [1]. Mathematical models of catabolite repression in E. coli The (isolated) reactions of the ... key players of catabolite repression. Mathematical modelling of signal transduction and gene expres- sion of the enzymes involved in the transport of carbohydrate...

Ngày tải lên: 18/02/2014, 13:20

9 727 0
Tài liệu Báo cáo khoa học: Nuclear receptors in the mosquito Aedes aegypti Annotation, hormonal regulation and expression profiling ppt

Tài liệu Báo cáo khoa học: Nuclear receptors in the mosquito Aedes aegypti Annotation, hormonal regulation and expression profiling ppt

... Vitellogenin, in the mosquito Aedes aegypti. Mol Cell Endocrinol 267, 97–105. 20 Velarde RA, Robinson GE & Fahrbach SE (2006) Nuclear receptors of the honey bee: annotation and expression in the ... reorganization of the follicular epithelium in the resulting adults [40]. DmE75A and DmE75B have been implicated in defining the transition stages 8 and 9 o...

Ngày tải lên: 18/02/2014, 13:20

22 578 0
Tài liệu Báo cáo khoa học: Electrostatic contacts in the activator protein-1 coiled coil enhance stability predominantly by decreasing the unfolding rate docx

Tài liệu Báo cáo khoa học: Electrostatic contacts in the activator protein-1 coiled coil enhance stability predominantly by decreasing the unfolding rate docx

... interaction stability at will; in particular, the ability to increase stability by kinetic design. For example, by achieving this predominantly by decelerating unfolding ⁄ dissocia- tion rates (which in our case ... change the stability of the dimeric structure by accelerating the association ⁄ folding rate (these processes are concomitant) and decreasing th...

Ngày tải lên: 18/02/2014, 13:20

14 540 0
Tài liệu Báo cáo khoa học: "Discourse Obligations in Dialogue Processing" docx

Tài liệu Báo cáo khoa học: "Discourse Obligations in Dialogue Processing" docx

... imposes. This includes some weak general obligations (such as acknowledging utterances by others and not inter- rupting) as well as some extra goals coming from the domain setting to maintain a shared ... plays the role of the dialogue manager in the TRAINS dialogue system which acts as an intelligent planning assistant in a transportation domain. While this is a domain where t...

Ngày tải lên: 20/02/2014, 21:20

8 477 0
Tài liệu Báo cáo khoa học: "Structure-Sharing in Lexical Representation" docx

Tài liệu Báo cáo khoa học: "Structure-Sharing in Lexical Representation" docx

... grammatical information appearing in the make entry below is a consequence of our maintaining the strong position that only infor- mation which is idiosyncratic should be included in a lexical ... while avoiding copy- ing information which can still be inherited; each rule takes as input a single-word lexical frame and produces a single-word lexical frame (no phrases in ei...

Ngày tải lên: 21/02/2014, 20:20

6 275 0
Báo cáo khoa học: "Recognizing Stances in Online Debates" docx

Báo cáo khoa học: "Recognizing Stances in Online Debates" docx

... challenging baseline methods. 1 Introduction This paper presents a method for debate-side clas- sification, i.e., recognizing which stance a per- son is taking in an online debate posting. In on- line ... Lin- guistics. Murthy Ganapathibhotla and Bing Liu. 2008. Mining opinions in comparative sentences. In Proceedings of the 22nd International Conference on Compu- tational Linguistic...

Ngày tải lên: 30/03/2014, 23:20

9 280 0
Báo cáo khoa học:Restricted walks in regular trees docx

Báo cáo khoa học:Restricted walks in regular trees docx

... translated into counting certain paths in the Cayley graph of F 2 , since each word in F 2 corresponds uniquely to a walk in the Cayley graph of F 2 , the in nite regular tree of degree four. In the ... point in T , and M, N two positive integers. Let W be the element in F r describing the path from the origin to P . Then the number of paths in T of length M + |U | + N beginn...

Ngày tải lên: 07/08/2014, 13:21

18 177 0
báo cáo khoa học: " Restricted cell elongation in Arabidopsis hypocotyls is associated with a reduced average pectin esterification level" ppsx

báo cáo khoa học: " Restricted cell elongation in Arabidopsis hypocotyls is associated with a reduced average pectin esterification level" ppsx

... for citation purposes) BMC Plant Biology Open Access Research article Restricted cell elongation in Arabidopsis hypocotyls is associated with a reduced average pectin esterification level Paul ... normal cell elongation in Arabidopsis hypocotyls. When the average DE% falls below this level, as in two gibberellic acid (GA) mutants ga1-3 and gai, and pla...

Ngày tải lên: 12/08/2014, 05:20

12 277 0
w