Báo cáo sinh học: "Reprogramming of the non-coding transcriptome during brain development" pot

báo cáo sinh học:" Review of the utilization of HEEPF – competitive projects for educational enhancement in the Egyptian medical sector" potx

báo cáo sinh học:" Review of the utilization of HEEPF – competitive projects for educational enhancement in the Egyptian medical sector" potx

... some projects, mainly in the medicine specialty of the medical sector (8.9%) Although QAAP is one of the six projects of the HEEP, 8.9% of the medical sector projects of the HEEPF addressed the ... Central Page 1 of 8 (page number not for citation purposes) Human Resources for Health Open Access Review Review of the utilization of HEEPF...

Ngày tải lên: 18/06/2014, 17:20

8 697 0
Báo cáo sinh học: " Oligomerization of the human immunodeficiency virus type 1 (HIV-1) Vpu protein – a genetic, biochemical and biophysical analysis" ppt

Báo cáo sinh học: " Oligomerization of the human immunodeficiency virus type 1 (HIV-1) Vpu protein – a genetic, biochemical and biophysical analysis" ppt

... R5- TM-F, CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGG AGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGT- GGACCATAGTATATATAGAATAGG and R5-TM-R, AATT CCTATTCTATATATACTATGGTCCACACGACTATT- GCTATGATTAGTGCTA CTATCAATGCTCCTACTC- CTAATTTATAATCTAAATTTAACATCTC. ... GAATTCACTACAGATCATCAATATCCCAAG; for the R5 vpu gene, Vpu- R5-F, GGATCCATGTTAAATTTA- GATTATAAATTAGGAGTA GG and Vpu- R5-R, GAAT- TCATTACAAATCATTAA...

Ngày tải lên: 18/06/2014, 18:20

11 436 0
Báo cáo sinh học: " Optimisation of the use of biomass for energy production (Optimierung der energetischen Biomassenutzung) - a funding programme introduces itself" ppt

Báo cáo sinh học: " Optimisation of the use of biomass for energy production (Optimierung der energetischen Biomassenutzung) - a funding programme introduces itself" ppt

... made available soon. Optimisation of the use of biomass for energy production (Optimierung der energetischen Biomassenutzung) - a funding programme introduces itself Energy, Sustainability and ... be evaluated according to the climate protection effects achieved. For example, these evaluations are undertaken on the basis of the biomass po...

Ngày tải lên: 18/06/2014, 18:20

19 559 0
Báo cáo sinh học: " Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" pptx

Báo cáo sinh học: " Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" pptx

... 9:36 http://www.translational-medicine.com/content/9/1/36 Page 4 of 14 Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus Haddad et al. Haddad ... Open Access Insertion of the human sodium iodide symporter to facilitate...

Ngày tải lên: 18/06/2014, 19:20

14 490 0
Báo cáo sinh học: "Review of the 25th Annual Scientific Meeting of the International Society for Biological Therapy of Cancer (now the Society for Immunotherapy of Cancer)" potx

Báo cáo sinh học: "Review of the 25th Annual Scientific Meeting of the International Society for Biological Therapy of Cancer (now the Society for Immunotherapy of Cancer)" potx

... leaders in the field, the 25th Annual Meeting of the International Society for Biological Therapy of Cancer (iSBTc, recently renamed the Society for Immunotherapy of Cancer, SITC) provided a scientific ... Guiding cancer immunotherapy from bench to bedside Review of the 25th annual scientific meeting of the International Societ...

Ngày tải lên: 18/06/2014, 19:20

10 480 0
Báo cáo sinh học: " Convergence of the modified Mann''''s iterative method for asymptotically kappa-strictly pseudocontractive mappings" pptx

Báo cáo sinh học: " Convergence of the modified Mann''''s iterative method for asymptotically kappa-strictly pseudocontractive mappings" pptx

... the result in Theorem KX true in the framework of the much general Banach space? Osilike et al. [5] proved the convergence theorems of modified Mann iteration method in the framework of q-uniformly ... to p, then Tx = p. Kim and Xu [6] studied weak and strong convergence theorems for the class of asymptotically κ-strictly pseudocontractive mappings in Hilbert sp...

Ngày tải lên: 18/06/2014, 22:20

14 309 0
Báo cáo sinh học: " Divergence of the mRNA targets for the Ssb proteins of bacteriophages T4 and RB69" ppt

Báo cáo sinh học: " Divergence of the mRNA targets for the Ssb proteins of bacteriophages T4 and RB69" ppt

... alignments between the Ssb proteins (gp32s) of T4 and RB69Figure 2 Amino-acid sequence alignments between the Ssb proteins (gp32s) of T4 and RB69. Residues and segments of the T4 gp32 sequence ... T4 gp32 and the phy- logenetic variant of this protein from the T4- like phage RB69. Yet, we also show that sequences of the mRNA tar- gets for th...

Ngày tải lên: 18/06/2014, 22:20

14 323 0
Báo cáo sinh học: " Comparisons of the M1 genome segments and encoded µ2 proteins of different reovirus isolates" pptx

Báo cáo sinh học: " Comparisons of the M1 genome segments and encoded µ2 proteins of different reovirus isolates" pptx

... making the T2J M1 gene and à2 proteins amongst the most divergent of all reovirus genes and proteins. Comparisons of these newly determined M1 and à2 sequences with newly determined M1 and à2 ... deter- minations of the M1 genome segments of reovirus T2J, nine other reovirus field isolates, and reovirus T3D clones obtained from several differe...

Ngày tải lên: 18/06/2014, 22:20

17 380 0
Báo cáo sinh học: " Characterization of the protease domain of Rice tungro bacilliform virus responsible for the processing of the capsid protein from the polyprotein" docx

Báo cáo sinh học: " Characterization of the protease domain of Rice tungro bacilliform virus responsible for the processing of the capsid protein from the polyprotein" docx

... Journal Open Access Research Characterization of the protease domain of Rice tungro bacilliform virus responsible for the processing of the capsid protein from the polyprotein Philippe Marmey 1 , ... demonstrated that the 37 kDa capsid protein was dependent on the presence of the protease in the constructs. Conclusion: The findings su...

Ngày tải lên: 19/06/2014, 08:20

12 263 0
Báo cáo sinh học: " Review of the temporal and geographical distribution of measles virus genotypes in the prevaccine and postvaccine eras" pdf

Báo cáo sinh học: " Review of the temporal and geographical distribution of measles virus genotypes in the prevaccine and postvaccine eras" pdf

... prevaccine and postvaccine eras and describes the geographically diverse distribution of some measles virus genotypes and the localized distributions of other genotypes. Introduction Although measles virus ... epidemiological links between cases in geographically distinct clusters. To determine the distribution of measles virus genotypes in the...

Ngày tải lên: 19/06/2014, 08:20

9 479 0
Báo cáo sinh học: "Analysis of the human cytomegalovirus genomic region from UL146 through UL147A reveals sequence hypervariability, genotypic stability, and overlapping transcripts" ppt

Báo cáo sinh học: "Analysis of the human cytomegalovirus genomic region from UL146 through UL147A reveals sequence hypervariability, genotypic stability, and overlapping transcripts" ppt

... is the first comparative study of all of the genomic compo- nents of the ORFs from UL146 through UL147A and the first report of multiple overlapping transcripts expressed from this region. The ... nucleotide sequences of the UL146- UL147A region, and in the case of CH1 and CH2 Northern analysis of temporal transcriptional pattern of UL14...

Ngày tải lên: 19/06/2014, 08:20

18 401 0
Báo cáo sinh học: "Reprogramming of the non-coding transcriptome during brain development" pot

Báo cáo sinh học: "Reprogramming of the non-coding transcriptome during brain development" pot

... to the function of lncRNAs While the above data suggest that the expression pattern of lncRNAs is at least as complex as that of mRNAs, a crucial question is the functional significance of the ... expression. To date, the molecular mechanism of function of the majority of lncRNAs remains unknown. However, the most informative clues to their possible mode of...

Ngày tải lên: 06/08/2014, 19:21

3 222 0
Báo cáo sinh học: "Consistency of the Neighbor-Net Algorithm" pot

Báo cáo sinh học: "Consistency of the Neighbor-Net Algorithm" pot

... func- tion, then the output of the Neighbor-Net algorithm is a circular split weight function ω : (X) → ޒ ≥0 with the prop- erty that d = d ω . The key part of the Neighbor-Net algorithm is the proce- dure ... Description of the Neighbor-Net algorithm In this section we present a detailed description of the Neighbor-Net algorithm, as implemented in the curr...

Ngày tải lên: 12/08/2014, 17:20

11 232 0
Báo cáo sinh học: " Evolution of the polymorphism at molecular markers in QTL and non-QTL regions in selected chicken lines (Open Access publication)" ppsx

Báo cáo sinh học: " Evolution of the polymorphism at molecular markers in QTL and non-QTL regions in selected chicken lines (Open Access publication)" ppsx

... matrices of genetic distances based on genotypes at supposedly neutral markers on the one hand, and at markers in QTL regions, on the other hand, showed that none of the markers in the QTL regions ... that helps to distinguish the in uence of selection from the in uence of drift. Here, we investigate the joint evolution ofneutral and selecte...

Ngày tải lên: 14/08/2014, 13:21

23 321 0
Từ khóa:
w