ASTM A 36 SPECIFICATION FOR CARBON STRUCTURAL STEEL SA-36 /SA-36M doc

Tài liệu Báo cáo khoa học: "Archivus: A multimodal system for multimedia meeting browsing and retrieval" doc

Tài liệu Báo cáo khoa học: "Archivus: A multimodal system for multimedia meeting browsing and retrieval" doc

... for Computational Linguistics Archivus: A multimodal system for multimedia meeting browsing and retrieval Marita Ailomaa, Miroslav Melichar, Martin Rajman Artificial Intelligence Laboratory ´ Ecole ... certain modalities has an im- pact on how they choose to use language when all modalities are available. On the backend, the wizards can also to some extent have an active role in encourag...

Ngày tải lên: 20/02/2014, 12:20

4 397 0
Tài liệu Báo cáo khoa học: "A Syntactic Framework for Speech Repairs and Other Disruptions" doc

Tài liệu Báo cáo khoa học: "A Syntactic Framework for Speech Repairs and Other Disruptions" doc

... states that repairs are available for semantic analysis but provides no details on the representation to be used. Clearly repairs should be available for se- mantic analysis as they play a ... work has proved adequate for a collection of human-human task-oriented dialogs, both in a full manual examination of the corpus, and in tests with a parser capable of parsing some...

Ngày tải lên: 20/02/2014, 19:20

8 489 0
Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx

Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx

... Annual Meeting of the Association for Computational Linguistics, pages 188-195. Ferreira da Silva, J. and G. Pereira Lopes (1999). A local maxima method and a fair dispersion normalization for ... mutual rank ratio, is a nonparametric rank-based approach which appears to perform significantly better than the standard association metrics. The body of the paper is organized a...

Ngày tải lên: 08/03/2014, 04:22

9 514 1
Báo cáo khoa học: "A Computational Framework for Composition in Multiple Linguistic Domains" doc

Báo cáo khoa học: "A Computational Framework for Composition in Multiple Linguistic Domains" doc

... 4 Information Structure and Tactical Constraints Entries in the eategorial lexicon have tactical con- straints, grammatical and semantic features, and phonological representation. Similar ... Multi-dimensional compo- sitional functions as a basis for grammatical anal- ysis. In R. T. Oehrle, E. Bach, and D. Wheeler, editors, Categorial Grammars and Natural Lan- guage Structures, D...

Ngày tải lên: 08/03/2014, 07:20

3 342 0
Embedded, Everywhere A Research Agenda for Networked Systems of Embedded Computers doc

Embedded, Everywhere A Research Agenda for Networked Systems of Embedded Computers doc

... (DOE) and the National Aeronautics and Space Administration (NASA) can play an im- portant role by sharing their specialized knowledge in this area with others working in less specialized areas ... Echelon Corporation; John Hines, National Aero- nautics and Space Administration; Rodger Lea, Sony Distributed Systems Laboratory; K. Venkatesh Prasad, Ford Research Laboratory; Jonathan Smith, Uni...

Ngày tải lên: 15/03/2014, 15:20

235 261 0
Báo cáo khoa học: "A Graphical Interface for MT Evaluation and Error Analysis" doc

Báo cáo khoa học: "A Graphical Interface for MT Evaluation and Error Analysis" doc

... M ` arquez. 2010b. Linguistic Measures for Automatic Machine Translation Evalua- tion. Machine Translation, 24(3–4):77–86. Ahmed El Kholy and Nizar Habash. 2011. Automatic Error Analysis for ... presents an application that shows how a set of heterogeneous automatic metrics can be used to evaluate a test bed of automatic translations. To do so, we have set up an online graphical inter...

Ngày tải lên: 16/03/2014, 20:20

6 455 0
Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

... that directly upstream of P HOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG GCCG-3¢ and 5¢ -ATCTTTCAAATAGAGCCTGG-3¢). The amplified DNA fragments were used to transform BFG2Z18-K3 5A, ... 5¢-AAATATAAAACGCTAGCGTCGACATGGC GC-3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3 ¢. The final ratio of target cells was determined by the number of colonies retaining the target gene divided by...

Ngày tải lên: 22/03/2014, 21:20

9 356 0
Báo cáo hóa học: " Research Article A Fluid Model for Performance Analysis in Cellular Networks" doc

Báo cáo hóa học: " Research Article A Fluid Model for Performance Analysis in Cellular Networks" doc

... OCIF leading to closed-form formula for the global outage probability and for the spatial outage probability. At last, this approach allows us to quantify cell breathing and network densification. References [1 ]A. M.ViterbiandA.J.Viterbi,“Erlangcapacityofapower controlled ... this formula, we are able to obtain the global outage probability as well as the spatial outage probability, which...

Ngày tải lên: 21/06/2014, 11:20

11 479 0
w