A Service-Oriented Approach for Aerodynamic Shape Optimization across Institutional docx

A Service-Oriented Approach for Aerodynamic Shape Optimization across Institutional docx

A Service-Oriented Approach for Aerodynamic Shape Optimization across Institutional docx

... this collaboration, several observations may be made: 1) The Grid concepts and tools provide a workable alternative that enables collaboration across traditional institutional boundaries without ... (termination condition = false) gen = gen + 1; apply genetic operators to Pop(gen) evaluate fitness of the population end A Service-Oriented Approach for Aerodynamic Shap...

Ngày tải lên: 27/06/2014, 17:20

6 307 0
a decentralized approach for implementing identity management in cloud computing

a decentralized approach for implementing identity management in cloud computing

... is that attacks differ from normal behavior. But the definition of what’s normal and what’s abnormal is ambiguous. For example, a particular user typically logs in around 10 am. But one day, ... Technologies, Cap Esterel. 2008. [6] R. H. Khan and J. Ylitalot and A. S. Ahmed, “OpenID Authentication As A Service in OpenStack,” Information Assurance and Security (IAS), 2011 7th Int...

Ngày tải lên: 31/07/2013, 09:43

7 591 0
Tài liệu Focusing Resources on Effective School Health: A FRESH Approach for Achieving Education for All doc

Tài liệu Focusing Resources on Effective School Health: A FRESH Approach for Achieving Education for All doc

... recognised as important in the community, and take advantage of a skilled workforce (teachers and administrators) that is already engaged with individual and organisational partners in the local community. ... services, a variety of approaches have already been tested and evaluated. For example, a recent evaluation of a school feeding programme in Burkina Faso found that school f...

Ngày tải lên: 14/02/2014, 09:20

30 420 0
Tài liệu Design for Sustainability a practical approach for Developing Economies doc

Tài liệu Design for Sustainability a practical approach for Developing Economies doc

... Fabrica Venus, Guatemala 7.2_ SWOT, Impact analysis and D4S Strategies at Talleres REA, Guatemala 7.3_ Production Chain project at Hacienda El Jobo, El Salvador 7.4_ Social aspects of sustainability: construction ... in Kampala, Uganda 7.8_ Product innovation: a solar lantern for the Cambodian market 7.9_ Product redesign: tailer for rural transport of crops in Ghana 7.10_ Ben...

Ngày tải lên: 21/02/2014, 05:20

128 514 0
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

... 956–964. 10 Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi H, Sakai H & Yamamoto K (1993) Isolation and characterization of recombinant human cathepsin E expressed ... Yasuda Y, Kageyama T, Akamine A, Shibata M, Kom- inami E, Uchiyama Y & Yamamoto K (1999) Charac- terization of new fluorogenic substrates for the rapid and sensitive assay of cathe...

Ngày tải lên: 07/03/2014, 09:20

12 647 0
Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc

Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc

... 1150 / January 2010 Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area by Lorenzo Cappiello, Arjan Kadareja, Christoffer Kok Sørensen and Marco ... the analysis are: Austria, Belgium, Finland, France, Germany, Greece, Ireland, Italy, the Netherlands, Portugal and Spain. Panel B: OLS panel regression of GDP on overall credit standards Dat...

Ngày tải lên: 15/03/2014, 10:20

30 915 0
A Conceptual Approach for Cannibalism Between Goods pot

A Conceptual Approach for Cannibalism Between Goods pot

... product of the same company. 1 A Conceptual Approach for Cannibalism Between Goods Mauro Laruccia, Universidade Braz Cubas (Brasil), mauro.laruccia@gmail.com Sandra Maria Correia Loureiro, ... private label brands account for a significant share of sales of retailers, particularly in the area of food. The growth in size and share of own brands can stimulate the development o...

Ngày tải lên: 16/03/2014, 11:20

5 367 0
Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

... that directly upstream of P HOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG GCCG-3¢ and 5¢ -ATCTTTCAAATAGAGCCTGG-3¢). The amplified DNA fragments were used to transform BFG2Z18-K3 5A, ... 5¢-AAATATAAAACGCTAGCGTCGACATGGC GC-3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3 ¢. The final ratio of target cells was determined by the number of colonies retaining the target gene divided by...

Ngày tải lên: 22/03/2014, 21:20

9 356 0
Báo cáo khoa học: "A Clustering Approach for the Nearly Unsupervised Recognition of Nonliteral Language" pdf

Báo cáo khoa học: "A Clustering Approach for the Nearly Unsupervised Recognition of Nonliteral Language" pdf

... to look at TroFi as a first step towards an unsupervised, scalable, widely applicable approach to nonliteral language processing that works on real-world data from any domain in any language. 329 just ... for av- erage recall. For overall performance, we take the f-score of average precision and average recall. We calculated two baselines for each word. T he first was a simple major...

Ngày tải lên: 24/03/2014, 03:20

8 448 0
w