Báo cáo hóa học: "MAXIMUM NORM ANALYSIS OF AN OVERLAPPING NONMATCHING GRIDS METHOD FOR THE OBSTACLE PROBLEM" pot
... types, see for example, [1, 6, 7, 11]. In this paper, we are interested in the error analysis in the maximum norm for the obstacle problem in the context of overlapping nonmatching grids: we consider ... provide a maximum norm analysis of an overlapping Schwarz method on nonmatch- ing grids for second-order elliptic obstacle problem. We consider a do...
Ngày tải lên: 22/06/2014, 22:20
... CTGGCATGGCTGGTGACTGA Canine primer sets used for real-time PCR analysis. The annealing temperature used for all analysis was 57°C. The melt temperature for the amplicon was obtained from the Rotorgene software and ... ACL- X and control stifles in any region studied (Figures 2 and 3). However the powers of the analyses were lower than 0.8, and therefore should be inter...
Ngày tải lên: 20/06/2014, 00:20
... ε 2 σ 2 m l=0 P l QA 2 QP l . (A.5) Therefore, Σ δ (m + 1) has the exact same form as (A.3) for k = m + 1. Thus, (10) is valid, and we can conclude the proof. B. Proof of Theorem 2 Before proving the theorem, first ... 1, there is an offset between the transmit time of the pulse at the sender and the arrivaltimeestimateatthereceiver. One source of this lag is T p , th...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo hóa học: " Research Article Convergence of a Mimetic Finite Difference Method for Static Diffusion Equation" doc
... method for the steady-state diffusion equation is developed and described. Then, in Section 5 we present the proof of the quadratic convergence rate of the new method. Next, the solution and analysis ... Guevara-Jordan et al. 9 and the standard finite difference method. The main parameters analyzed in these test problems are the rate of convergence and the number...
Ngày tải lên: 22/06/2014, 19:20
Báo cáo hóa học: "Review Article T -Stability Approach to Variational Iteration Method for Solving Integral Equations" pot
... 0 and α |λ| b a b a K 2 x, tdxdt 1/2 , then stability of the nonlinear mapping T in the norm of L 2 a, b is a coefficient condition for the above iteration to converge in the norm of ... L 0andα |λ|/3 shows that 1.1 holds for the nonlinear mapping T. All of the conditions of Theorem 1.1 hold for the nonlinear mapping T and hence it is T-stable...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo hóa học: "Microrna profiling analysis of differences between the melanoma of young adults and older adults" pot
... microRNA analysis and assisted in interpreting the data (using ABqPCR software). LMD assisted in the retrieval of the FFPE specimens, selection of cases and editing of the manuscript. JMK performed the ... to the firs t and has the largest variance over the samples of all such orthogonal linear combinations, and so on. The samples were first centered by their means...
Ngày tải lên: 18/06/2014, 16:20
báo cáo hóa học: " A kinematic analysis of a haptic handheld stylus in a virtual environment: a study in healthy subjects" pptx
... out the study, drafted the manuscript and made the statistical analyses. KSS and MR participated in its design and co-ordination and helped to draft the manu- script and make the statistical analyses. A ... not have any significant effect on the difference in holding the haptic handheld stylus. Detailed recording of hand movements The visual inspection of the detailed x-...
Ngày tải lên: 19/06/2014, 10:20
Báo cáo hóa học: " A comprehensive analysis of the naturally occurring polymorphisms in HIV-1 Vpr: Potential impact on CTL epitopes" doc
... comprehensive analysis of the extent of variation at the amino acid level in the aux- iliary gene product Vpr of HIV-1. The underlying reasons for the selection of Vpr for a com- prehensive analysis are the ... RC and AC participated in the analysis of the predicted amino acid sequences of Vpr. SM, DD and BS provided information regarding the structure-...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " A comparative analysis of viral matrix proteins using disorder predictors" docx
... fact, analysis of the crys- tal structure of the p15 protein revealed that residues 46 and 78 of the chain A are involved in interaction with the residues 114 and 105 of the chain B. All these ... Influenza than of disorder patterns of HIV/SIV Analysis of Figure 2 reveals that the pattern of the pre- dicted disorder in EIAV matrix protein is closer to that...
Ngày tải lên: 20/06/2014, 01:20