báo cáo hóa học:" Research Article Bifurcation Analysis for a Delayed Predator-Prey System with Stage Structure" pdf

Báo cáo hóa học: " Research Article Call Admission Control Jointly with Resource " doc

Báo cáo hóa học: " Research Article Call Admission Control Jointly with Resource " doc

... 2008. [11] S. A. Alqahtani, A. S. Hassan Mahmoud, and A. Alshanyour, “Performance evaluation and analytical modeling of novel dynamic call admission control scheme for 3G and beyond cellular wireless ... the arrival of a new or handoff data calls, arriving data calls use the remaining bandwidth from the prioritized calls. This leads to available bandwidth usage of the data calls and bet...

Ngày tải lên: 20/06/2014, 22:20

10 398 0
Báo cáo hóa học: " S1 gene sequence analysis of a nephropathogenic strain of avian infectious bronchitis virus in Egypt" docx

Báo cáo hóa học: " S1 gene sequence analysis of a nephropathogenic strain of avian infectious bronchitis virus in Egypt" docx

... TTCTGCTATGAAAAATGGCCAGTTTTTCTATAATTTAACAGTTAGTGTAGCTAAGTACCCTACTTTTAAATCATTTCAGTGTGTTAATAATTTAACATCCGTATATTTAAATGGTGATCT H120 399 C T M41 481 C Egypt/F/03 519 TGTTTACACCTCTAATGAGACCACAGATGTTACATCTGCAGGTGTTTATTTTAAAGCTGGTGGACCTATAACTTATAAAGTTATGAGAGAAGTTAAAGCCCTGGCTTATTTTGTTAATGG H120 ... TTCATATGAAGGTCCTTTGCTTTGTAAAGGTGTTTATTCGGGTGAGTTAGACCATAATTTTGAATGTGGACTGTTAGTTTATGTTACTAAGAGCGGTGGCTCTC...

Ngày tải lên: 20/06/2014, 01:20

9 263 0
báo cáo hóa học:" Cytokine Profiles in Human Immunodeficiency Virus-Infected Children Treated With Highly Active " pdf

báo cáo hóa học:" Cytokine Profiles in Human Immunodeficiency Virus-Infected Children Treated With Highly Active " pdf

... treatment with HAART were fitted by nonlinear regression. The statistical software used was GraphPad Prism Version 4.00 for Win- dows (GraphPad Software; San Diego, California, USA, www.graphpad.com ). Results Twelve ... The assay performed favorably when data from groups of patients were pooled for statistical com- parison, but there was wide variation in values for differ- ent subje...

Ngày tải lên: 20/06/2014, 08:20

9 347 0
Báo cáo hóa học: " BOB-RED queue management for IEEE 802.15.4 wireless sensor networks" pdf

Báo cáo hóa học: " BOB-RED queue management for IEEE 802.15.4 wireless sensor networks" pdf

... queue K a preset threshold value to separate different dropping strategy for real-time data and non-real-time data l rt real-time data generation rate l nrt non-real-time data generation rate μ rt service ... management scheme such as RED and DropTail, (3) different traffic loads with dynamic adaptation scheme. Simulation results show that RED queue management scheme accompanied with...

Ngày tải lên: 20/06/2014, 22:20

16 445 0
Báo cáo khoa học: "Learning Surface Text Patterns for a Question Answering System" doc

Báo cáo khoa học: "Learning Surface Text Patterns for a Question Answering System" doc

... the form of widespread bureaucratic abuses: graft, nepotism…”; for “what is sonar?” the pattern “<NAME> and related <ANSWER>s” matches “…while its sonar and related underseas systems ... be written as “Wolfgang Amadeus Mozart”, “Mozart, Wolfgang Amadeus”, “Amadeus Mozart” or “Mozart”. To learn from such variations, in step 1 of Algorithm 1 we specify the various ways in...

Ngày tải lên: 08/03/2014, 07:20

7 253 0
báo cáo hóa học:" Gene and microRNA analysis of neutrophils from patients with polycythemia vera and essential thrombocytosis: down-regulation of micro RNA-1 and -133a" pot

báo cáo hóa học:" Gene and microRNA analysis of neutrophils from patients with polycythemia vera and essential thrombocytosis: down-regulation of micro RNA-1 and -133a" pot

... preformed research, and analyzed data; MB designed the study, analyzed the data and wrote the paper; NZ preformed research and analyzed the data; SA preformed research and analyzed the data; EW designed ... DNA Analyzer and analyzed utilizing standard alignment software. RNA Preparation, RNA Amplification and Labeling for Oligonucleotide Microarray Total RNA from harvested neutrophils...

Ngày tải lên: 18/06/2014, 15:20

17 526 0
báo cáo hóa học:" Comprehensive molecular etiology analysis of nonsyndromic hearing impairment from typical areas in China" doc

báo cáo hóa học:" Comprehensive molecular etiology analysis of nonsyndromic hearing impairment from typical areas in China" doc

... children has not been investigated systematically, and effective genetic evalua- tion strategies for hearing impairment are not available in most areas of China. China is a large country with a pop- ulation ... race-matched controls with normal hearing using a commercially avail- able DNA extraction kit (Watson Biotechnologies Inc, Shanghai, China). Mutational analysis DNA seque...

Ngày tải lên: 18/06/2014, 15:20

12 511 0
Báo cáo hóa học: " Mass spectrometry-based analysis of therapy-related changes in serum proteome patterns of patients with early-stage breast cancer" pot

Báo cáo hóa học: " Mass spectrometry-based analysis of therapy-related changes in serum proteome patterns of patients with early-stage breast cancer" pot

... spectra were recorded for each sample). All samples were analyzed in a random sequence to avoid a possible batch effect. Data Processing and Statistical Analysis The preprocessing of spectral data ... spectrometry-based analysis of therapy-related changes in serum proteome patterns of patients with early- stage breast cancer Journal of Translational Medicine 2010, 8:66 Pietrows...

Ngày tải lên: 18/06/2014, 16:20

11 392 0
báo cáo hóa học: " Virtual reality and physical rehabilitation: a new toy or a new research and rehabilitation tool?" pptx

báo cáo hóa học: " Virtual reality and physical rehabilitation: a new toy or a new research and rehabilitation tool?" pptx

... Craig A: Understanding virtual reality: Interface, application, and design California: Morgan Kaufmann; 2002. 7. Stanney KM: Handbook of Virtual Environments: Design, Implementation, and Applications ... FOV is smaller than that available with other VR systems but the accompanying pixel visual angle is also smaller and, therefore, better. With projection-based VR, the computer generated...

Ngày tải lên: 19/06/2014, 10:20

2 364 0
w