Báo cáo toán học: " Two-stage source tracking method using a multiple linear regression model in the expanded phase domain" pdf

Báo cáo toán học: " Two-stage source tracking method using a multiple linear regression model in the expanded phase domain" pdf

Báo cáo toán học: " Two-stage source tracking method using a multiple linear regression model in the expanded phase domain" pdf

... as: Yang and Kang: Two-stage source tracking method using a multiple linear regression model in the expanded phase domain. EURASIP Journal on Advances in Signal Processing 2012 2012:5. Yang and ... valid in the expanded phase domain. Finally, the estimator determines the most accurate delay among the estimated results in each expanded phase do...

Ngày tải lên: 20/06/2014, 20:20

19 455 0
Báo cáo khoa học: Evolutionary origin and divergence of PQRFamide peptides and LPXRFamide peptides in the RFamide peptide family pdf

Báo cáo khoa học: Evolutionary origin and divergence of PQRFamide peptides and LPXRFamide peptides in the RFamide peptide family pdf

... identified in the lamprey brain a novel RFamide peptide with a C-ter- minal PQRFamide motif (lamprey PQRFa). RNA preparation Total RNA was extracted from lamprey brains using Sepa- zol-RNA I Super (Nacalai ... 661–667. 10 Satake H, Hisada M, Kawada T, Minakata H, Ukena K & Tsutsui K (2001) Characterization of a cDNA encoding a novel avian hypothalamic neuropeptide exerting an...

Ngày tải lên: 07/03/2014, 12:20

13 503 0
Báo cáo khoa học: "PART-OF-SPEECH TAGGING USING A VARIABLE MEMORY MARKOV MODEL" doc

Báo cáo khoa học: "PART-OF-SPEECH TAGGING USING A VARIABLE MEMORY MARKOV MODEL" doc

... POS tagging, we are interested in learning a sub-class of finite state machines which have the following property. Each state in a machine M belonging to this sub-class is labeled by a string ... assumptions for the static tag probabilities, are encouraging. VARIABLE MEMORY MARKOV MODELS Markov models are a natural candidate for lan- guage modeling and temporal pattern...

Ngày tải lên: 23/03/2014, 20:21

7 303 0
Báo cáo toán học: " Automated target tracking and recognition using coupled view and identity manifolds for shape representation" pot

Báo cáo toán học: " Automated target tracking and recognition using coupled view and identity manifolds for shape representation" pot

... view manifold, while the others are interpolated. The first and second training shapes are 12° apart along the azimuth angle, and the second and third ones are 10° apart in the elevation angle. ... Identity manifold The identity manifold that plays a central role in our work is intended to capture both inter-class and intra- class shape variability among training targets. I...

Ngày tải lên: 20/06/2014, 21:20

17 326 0
Báo cáo toán học: " SSIM-inspired image restoration using sparse representation" docx

Báo cáo toán học: " SSIM-inspired image restoration using sparse representation" docx

... corresponding to the (ij) block of the image, ˆ X is the estimated image, λ is the regularization parameter, and W is the image obtained by averaging the blocks obtained using the sparse coefficients ... represented as the linear combination of dictio- nary atoms. This way, in the space of image patches, we are omitting image patches in the direction of structural di...

Ngày tải lên: 20/06/2014, 20:20

34 351 0
Báo cáo toán học: " Overview of principles and implementations to deal with spatial issues in monitoring environmental effects of genetically modified organisms" pot

Báo cáo toán học: " Overview of principles and implementations to deal with spatial issues in monitoring environmental effects of genetically modified organisms" pot

... on harmonised or standardised methods [43] so that the data can be compared and used for statistical analysis and modelling. The monitoring data should allow for spatial extrapolation in order ... quality control data), measuring data and geodata. An appropriate tool to achieve these goals is the implementation of a web-based GIS that contains relevant geodata and offers tools f...

Ngày tải lên: 20/06/2014, 20:20

17 560 0
Báo cáo toán học: "Identification of mosquito larvicidal bacterial strains isolated from north Sinai in Egypt" pot

Báo cáo toán học: "Identification of mosquito larvicidal bacterial strains isolated from north Sinai in Egypt" pot

... H E L P S R ctttattacactaacaatattgaaaataatagcaacatattaatttctaataaggaacaa L Y Y T N N I E N N S N I L I S N K E Q atatatttaaccttgccttcacttccagaaaacgagcaataccctaaaactccagtatta I Y L T L P ... EMCC1931, 51 kDa cctgttcaatgggaagaatttactaattacccgctaaatactactcctacaagcctaaat P V Q W E E F T N Y P L N T T P T S L N tataaccttccagaaatatcaaaaaaattttataaccttaagaataaatattcacggaat Y N L P ......

Ngày tải lên: 20/06/2014, 20:20

33 319 0
Báo cáo toán học: "Heterologous expression and optimization using experimental designs allowed highly efficient production of the PHY US417 phytase in Bacillus subtilis 168" ppt

Báo cáo toán học: "Heterologous expression and optimization using experimental designs allowed highly efficient production of the PHY US417 phytase in Bacillus subtilis 168" ppt

... Wheat bran was obtained from the local company “Nutrisud/Medimix”. All other chemicals used in this study are commercially available in analytical grade. DNA manipulation General molecular ... fermentation with agricultural waste using statistical approach. New Biotechnol 27: 25–32 Farhat A, Chouayekh H, Ben Farhat M, Bouchaala K, Bejar S (2008) Gene cloning and characteriz...

Ngày tải lên: 20/06/2014, 20:20

34 441 0
Báo cáo toán học: " Positive periodic solutions for neutral multi-delay logarithmic population model" pot

Báo cáo toán học: " Positive periodic solutions for neutral multi-delay logarithmic population model" pot

... most natural populations change with time and that such changes induce variation in the growth characteristics of populations. Among many population models, the neutral logarithmic population model ... that they have no competing interests. Authors’ contributions All authors contributed equally to the manuscript and read and approved the final manuscript. Acknowledgments The auth...

Ngày tải lên: 20/06/2014, 21:20

18 288 0
w