báo cáo hóa học: " A comparative study on approximate entropy measure and poincaré plot indexes of minimum foot clearance variability in the elderly during walking" pptx

Báo cáo khoa học: "A Comparative Study on Generalization of Semantic Roles in FrameNet" ppt

Báo cáo khoa học: "A Comparative Study on Generalization of Semantic Roles in FrameNet" ppt

... 43rd Annual Meet- ing on Association for Computational Linguistics, pages 173–180. Massimiliano Ciaramita and Yasemin Altun. 2006. Broad-coverage sense disambiguation and informa- tion extraction ... 28(3):245–288. Ana-Maria Giuglea and Alessandro Moschitti. 2006. Semantic role labeling via FrameNet, VerbNet and PropBank. In Proceedings of the 21st International Conference on...

Ngày tải lên: 17/03/2014, 01:20

9 553 0
Báo cáo khoa học: "A Comparative Study on Reordering Constraints in Statistical Machine Translation" potx

Báo cáo khoa học: "A Comparative Study on Reordering Constraints in Statistical Machine Translation" potx

... Regard- ing the Viterbi alignment in training, the baseline ITG constraints yield a similar coverage as the IBM constraints on the Verbmobil task. On the Canadian Hansards task the baseline ITG constraints ... 2002. Discriminative training and maximum entropy models for statistical machine translation. In Proc. of the 40th Annual Meeting of the Association fo...

Ngày tải lên: 17/03/2014, 06:20

8 410 0
Báo cáo khoa học: "A Comparative Study of Reinforcement Learning Techniques on Dialogue Management" pdf

Báo cáo khoa học: "A Comparative Study of Reinforcement Learning Techniques on Dialogue Management" pdf

... that SARSA(λ), Q-Learning, Q(λ) and AC-QV are significantly faster than the rest algorithms. On the other hand, all algorithms except for NAC, IAC and LS-SARSA have the major draw- back of the ... with varying  and available action density values. At each run, each algorithm was evaluated using the same transition probabilities and available actions. To assess how the...

Ngày tải lên: 17/03/2014, 22:20

10 506 0
Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx

Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx

... the number of epochs, and N is the number of training samples. 3 Evaluations From the four tasks we consider, parsing and lan- guage model adaptation are both examples of re-ranking. In these ... first investigate all of our estimators on two re-ranking tasks: a parse selection task and a language model (LM) adaptation task. Then we apply the best of the...

Ngày tải lên: 08/03/2014, 02:21

8 506 0
Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

... Takezawa, E. Sumita, F. Sugaya, H. Yamamoto, and S. Yamamoto. 2002. Toward a broad-coverage bilingual corpus for speech translation of travel conversations in the real world. In Proceeding of ... word alignments, and then continuously add new links between backbone and hypothesis if and only if both of the two words of the new link are un- aligned and this l...

Ngày tải lên: 17/03/2014, 01:20

8 548 1
Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx

Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx

... time of the contaminating hydrazone was consistent with the impurity in the l-lactaldehyde preparation being acetone or propionaldehyde (as shown by comparison with the hydra- zones of acetone and ... hydrazone plus an additional hydrazone (the contaminant was not present in the unde- rivatized l-lactaldehyde preparation, or the 2,4-dinitro- phenylhydrazine reagent). T...

Ngày tải lên: 23/03/2014, 06:20

11 646 0
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

... ATATAT CATATGTCCGGTGTCGCAAAG R-TryX ATATA GGATCCTTACTCGTCTCTCCACGG F-TryP1 ATATAT CATATGTCCTGCGGTAACGCC R-TryP1 ATATA GGATCCTTACTGCTTGCTGAAGTATC F-TDPX1 Cys35Ala CAACGTAGCCAGCAAG GCCGGCTTCACCAAGGGCG R-TDPX1 Cys35Ala ... codons of the mutated amino acids are in bold. Cloned protein or mutation primer (5’- to 3’) F-TDPX1 TATAT CATATGTCTATCTACGACTTCAAGGTC R-TDPX1 ATATA GGATCCTCACGATTGAGTGC...

Ngày tải lên: 23/03/2014, 07:20

16 484 0
Báo cáo khoa học: "A Comparative Study of Target Dependency Structures for Statistical Machine Translation" ppt

Báo cáo khoa học: "A Comparative Study of Target Dependency Structures for Statistical Machine Translation" ppt

... translation. In Proceedings of ACL, pages 311–318. Adam Pauls and Dan Klein. 2011. Faster and smaller n-gram language models. In Proceedings of the 49th Annual Meeting of the Association for Computational Linguistics: ... Computational Linguistics, 37(1):197–230. Ryan McDonald, Koby Crammer, and Fernando Pereira. 2005. Online large-margin training of dependency parsers....

Ngày tải lên: 30/03/2014, 17:20

5 412 0
Báo cáo sinh học: " A comparative study of some methods for color medical images segmentation" pdf

Báo cáo sinh học: " A comparative study of some methods for color medical images segmentation" pdf

... uniformity of a region. In contrast, [20,21] use a pairwise region comparison rather than applying a uniformity criterion to each individual region. A number of approaches to segmentation are based on ... when pairs of human segmentations of the same image are compared, both the GCE and the LCE are low; conversely, when random pairs of human segmentations are com...

Ngày tải lên: 18/06/2014, 22:20

42 351 0
Báo cáo hóa học: " A validation study using a modified version of Postural Assessment Scale for Stroke Patients: Postural Stroke Study in Gothenburg (POSTGOT)" doc

Báo cáo hóa học: " A validation study using a modified version of Postural Assessment Scale for Stroke Patients: Postural Stroke Study in Gothenburg (POSTGOT)" doc

... in the conception and design. CUP was primary responsible in the collection, statistical analysis and interpretation of data and in drafting the manuscript. POH, AD and KSS were involved in the ... the PASS before. The aim of this study was to assess the intrarater and the interrater reliability for the grading of postural balance using a modified...

Ngày tải lên: 19/06/2014, 08:20

8 408 0
w