báo cáo hóa học: " Application of a hybrid wavelet feature selection method in the design of a self-paced brain interface system" pptx

báo cáo hóa học: " Application of a hybrid wavelet feature selection method in the design of a self-paced brain interface system" pptx

báo cáo hóa học: " Application of a hybrid wavelet feature selection method in the design of a self-paced brain interface system" pptx

... for ranking features based on the amount of discriminative information each carries [21]. We then applied a GA in a wrapper approach to select the features that lead to the best classification ... similar in shape to that of a particular wavelet function. It therefore has an advantage over other feature extraction methods that operate in only one domain, such as the...

Ngày tải lên: 19/06/2014, 10:20

13 530 0
báo cáo hóa học: " Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia-stimulated expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in astrocytes" pdf

báo cáo hóa học: " Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia-stimulated expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in astrocytes" pdf

... GACTCAGAAA AGGACAAGGG GTGAGCCCAA CCACACAG CTGC-3' MCP-5: GenBank Accessions # AC012294, NC_000077 5'-AAACACAGCTTAAAATAAAACAAAGAGGACGTGAGG-3' 5'-CAACTACAG AATCGGCGTGTGCCA-3' 5'-TCACGTG CTGTTATAATGTTGTTAAGCAGAAGATTCACGTCC-3' Journal ... confirm accuracy. A mutant sequence (5'-AAGCAGATTTG GTACCCT- TAGTCTTGCTTTAACGCTACTTTTCC AAGATAAGGT GACTCAGAAA AGGACAA...

Ngày tải lên: 19/06/2014, 22:20

15 542 0
Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt

Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt

... Lactobacillus reuteri Hema Vaidyanathan 1 , Vijayalakshmi Kandasamy 1 , Gopi Gopal Ramakrishnan 1 , KB Ramachandran 2 , Guhan Jayaraman 2 and Subramanian Ramalingam 1* Abstract In this work, Lactobacillus reuteri has ... levels being 25% lesser than that of the native strain. Interestingly, the recombinant strain exhibited elevated rates of lactate and ethanol formation as well as r...

Ngày tải lên: 20/06/2014, 23:20

8 402 0
báo cáo hóa học: " Robot-assisted reaching exercise promotes arm movement recovery in chronic hemiparetic stroke: a randomized controlled pilot study" pptx

báo cáo hóa học: " Robot-assisted reaching exercise promotes arm movement recovery in chronic hemiparetic stroke: a randomized controlled pilot study" pptx

... 2). Statistical analysis An initial statistical analysis was made using a doubly multivariate repeated measures analysis of variance (ANOVA), with evaluation session as the within-subject (repeated) ... post-training). Like- wise, the univariate and multivariate tests did not change in the free reaching or functional measures indicating that Changes in supported fraction of ra...

Ngày tải lên: 19/06/2014, 10:20

13 396 0
báo cáo hóa học:" Airborne particulate matter PM2.5 from Mexico City affects the generation of reactive oxygen species by blood neutrophils from asthmatics: an in vitro approach" docx

báo cáo hóa học:" Airborne particulate matter PM2.5 from Mexico City affects the generation of reactive oxygen species by blood neutrophils from asthmatics: an in vitro approach" docx

... 4). Paraoxonase Activity in Plasma The plasma paraoxonase activity was expressed as nmol of p-nitrophenol phosphate formed per milligram of apoli- poprotein A (Table 2). The paraoxonase activity ... respiratory disorders, including bronchial asthma [26]. In particular, increasing evidence shows that chronic airway inflamma- tion typical of asthma results in increased oxidati...

Ngày tải lên: 20/06/2014, 00:20

11 512 0
báo cáo hóa học:" Progressive obesity leads to altered ovarian gene expression in the Lethal Yellow mouse: a microarray study" pptx

báo cáo hóa học:" Progressive obesity leads to altered ovarian gene expression in the Lethal Yellow mouse: a microarray study" pptx

... in microarray analyses. KE performed RNA extractions and microarray analyses, and performed statistical analyses on microarray data. JB performed final data analysis and drafted the manuscript. All authors ... the cRNA and washed again. An Axon Gene- Pix Scanner was used to scan the microarrays. GenePix Pro software (MDS, Inc., Toronto, ON) was used to acquire and align the microarr...

Ngày tải lên: 20/06/2014, 07:20

9 347 0
báo cáo hóa học:" HIV-related restrictions on entry, residence and stay in the WHO European Region: a survey" ppt

báo cáo hóa học:" HIV-related restrictions on entry, residence and stay in the WHO European Region: a survey" ppt

... influenza virus A (H1N1). Together with international organizations, such as the International AIDS Society (IAS) [10], t he Inter- national Organization for Migration and the Joint Uni- ted Nations ... foreigners applying for residence or a work p ermit. In the German s tate of Bavaria, an HIV test can be required for people staying for more than 180 days, while in the stat...

Ngày tải lên: 20/06/2014, 08:20

6 404 0
báo cáo hóa học:" How do existing HIV-specific instruments measure up? Evaluating the ability of instruments to describe disability experienced by adults living with HIV" pot

báo cáo hóa học:" How do existing HIV-specific instruments measure up? Evaluating the ability of instruments to describe disability experienced by adults living with HIV" pot

... Shifting perspectives: reconceptualizing HIV disease within a rehabilitation framework. Physiotherapy Canada. Physiotherapy Canada 2000, 52:189-207. 37. Namisango E, Katabira E, Karamagi C, Baguma ... the manuscript. KK participated in the document analysis, interpretation of findings, and helped to draft the manuscript. All authors have read and approved the final manuscript. C...

Ngày tải lên: 20/06/2014, 16:20

10 555 0
báo cáo hóa học: " Reduced inflammation accompanies diminished myelin damage and repair in the NG2 null mouse spinal cord" potx

báo cáo hóa học: " Reduced inflammation accompanies diminished myelin damage and repair in the NG2 null mouse spinal cord" potx

... kkucharo@sanfordburnham.org 1 Sanford-Burnham Medical Research Institute, La Jolla, CA 92037, USA Full list of author information is available at the end of the article Kucharova et al. Journal of Neuroinflammation 2011, ... for revascularization of the lesion and repair of t he blood brain barrier likely plays an important rol e in the heal- ing process. How ever, vascu...

Ngày tải lên: 19/06/2014, 22:20

13 480 0
w