Báo cáo hóa học: " Hypothesis testing for evaluating a multimodal pattern recognition framework applied to speaker detection" doc

Tài liệu Báo cáo khoa học: "Different Structures for Evaluating Answers to Complex Questions: Pyramids Won’t Topple, and Neither Will Human Assessors" docx

Tài liệu Báo cáo khoa học: "Different Structures for Evaluating Answers to Complex Questions: Pyramids Won’t Topple, and Neither Will Human Assessors" docx

... years, NIST has implemented an evaluation methodology based on the notion of “information nuggets” to assess an- swers to complex questions. As it has become the de facto standard for evaluating ... macro- averaging better quantifies performance. In classi- fication tasks, imbalance in the prevalence of each class can lead to large differences in macro- and micro-averaged scores. Anal...

Ngày tải lên: 20/02/2014, 12:20

8 508 0
Báo cáo khoa học: "Vocabulary Decomposition for Estonian Open Vocabulary Speech Recognition" ppt

Báo cáo khoa học: "Vocabulary Decomposition for Estonian Open Vocabulary Speech Recognition" ppt

... Vesa Siivola, Matti Var- jokallio, Ebru Arisoy, Murat Saraclar and Andreas Stolcke 2007. Analysis of Morph-Based Speech Recognition and the Modeling of Out-of-Vocabulary Words Across Languages To ... orthographic irregularity. A uni- versal approach to vocabulary decomposition would have to take all of these factors into account. Acknowledgements The authors would like to thank Dr...

Ngày tải lên: 08/03/2014, 02:21

7 378 0
Tài liệu Báo cáo khoa học: "Liars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates" pdf

Tài liệu Báo cáo khoa học: "Liars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates" pdf

... potentially involved (Riloff and Wiebe., 2003; Sarmento et al., 2009). Alternative approaches to automatic and manual construction of sentiment corpora have been pro- posed. For example, Kim and ... that each opinio- nated text is associated to a numeric rating, which does not exist for most of opinionated texts availa- ble on the web. In addition, the corpus annotation is perf...

Ngày tải lên: 20/02/2014, 05:20

5 506 0
Báo cáo khoa học: Gc recruitment system incorporating a novel signal amplification circuit to screen transient protein-protein interactions pot

Báo cáo khoa học: Gc recruitment system incorporating a novel signal amplification circuit to screen transient protein-protein interactions pot

... extracted, and the target Z I3 1A gene was amplified by PCR with primers 5¢-AAATA TAAAACGCTAGCGTCGACATGGCGC-3¢ and 5¢-AGC GTAAAGGATGGGGAAAG-3¢. The final ratio of target cells was determined by counting ... 67–79. 8 Takesako K, Ikai K, Haruna F, Endo M, Shimanaka K, Sono E, Nakamura T, Kato I & Yamaguchi H (1991) Aureobasidins, new antifungal antibiotics. Taxonomy, fermentation, isolation,...

Ngày tải lên: 05/03/2014, 23:20

9 537 0
Báo cáo khoa học: Analysis of dopamine transporter gene expression pattern ) generation of DAT-iCre transgenic mice doc

Báo cáo khoa học: Analysis of dopamine transporter gene expression pattern ) generation of DAT-iCre transgenic mice doc

... was a 200 bp DNA fragment of DAT ge- nomic DNA amplified by PCR (using the primers 3¢-CAT GCTAGCTAAAAGCAAATGCTCCGTGGG and 3¢-CTA GTATACGAAACCTCCAGACATTGGCCA), digested with BstZ17I and NheI, and ... 319 bp 5¢ DNA fragment of the DAT gene was ampli- fied by PCR (using the primers 5¢-CTAGGTACCA CAAGCCGGCGTTAATGTGAA and 5¢-CTAATCGAT GGAGCCCGAGGAAGTCTGTTT), digested with ClaI and KpnI, and insert...

Ngày tải lên: 30/03/2014, 08:20

10 422 0
Báo cáo khoa học: "Hypothesis Mixture Decoding for Statistical Machine Translation" ppt

Báo cáo khoa học: "Hypothesis Mixture Decoding for Statistical Machine Translation" ppt

... and 2008 (MT08) data sets. All bilingual corpora available for the NIST 2008 constrained data track of Chinese -to- English MT task are used as training data, which contain 5.1M sentence pairs, ... Papineni, Salim Roukos, Todd Ward, and Weijing Zhu. 2002. BLEU: a method for automatic evaluation of machine translation. In Proceedings of the Association for Computational Linguist...

Ngày tải lên: 07/03/2014, 22:20

10 394 0
Báo cáo khoa học: "Medical treatment for the terminally ill: the ‘risk of unacceptable badness’"

Báo cáo khoa học: "Medical treatment for the terminally ill: the ‘risk of unacceptable badness’"

... to emphasize what Streat and coworkers [15] termed, ‘the large risk of unacceptable badness’, rather than a vanishingly small potential for benefit. There are far worse things than death, and many of them ... exists to manipulate it. Life support generates an outcome that is no longer inevitably fatal. 4. Physicians do not have an exceptional track record in explaining end-of-life iss...

Ngày tải lên: 25/10/2012, 10:45

2 465 0
Báo cáo y học: "Clinical Strategy for the Management of Solid Pseudopapillary Tumor of the Pancreas: Aggressive or Less"

Báo cáo y học: "Clinical Strategy for the Management of Solid Pseudopapillary Tumor of the Pancreas: Aggressive or Less"

... Provincial Hospital affiliated to Shandong University, Jinan Shandong, China; 2. Department of Rehabilitation, Shandong Provincial Hospital affiliated to Shandong University, Jinan Shandong, China. ... et al. Papillary cystic neoplasm of the pancreas with liver metastasis coexisting with thyroid papillary carcinoma. Arch Pathol Lab Med. 1995;119:268-273. 26. Machado MC, Machado MA, B...

Ngày tải lên: 25/10/2012, 11:40

5 642 0
Báo cáo y học: "High-Resolution Flow Cytometry: a Suitable Tool for Monitoring Aneuploid Prostate Cancer Cells after TMZ and TMZ-BioShuttle Treatment"

Báo cáo y học: "High-Resolution Flow Cytometry: a Suitable Tool for Monitoring Aneuploid Prostate Cancer Cells after TMZ and TMZ-BioShuttle Treatment"

... permanent radioactive implants (brachytherapy) [7]. iv) The standard initial systemic therapy for locally advanced or metastatic disease is hormonal or androgen depri- vation therapy (ADT) that ... PJ. Targeting uPA/uPAR in prostate cancer. Cancer Treat. Rev. 2007;33(6):521-7 3. Catalona WJ and Smith DS. 5-year tumor recurrence rates after anatomical radical retropubic prostatectomy...

Ngày tải lên: 26/10/2012, 09:48

10 411 0
Báo cáo y học: "Enhanced surveillance for childhood hepatitis B virus infection in Canada, 1999-2003"

Báo cáo y học: "Enhanced surveillance for childhood hepatitis B virus infection in Canada, 1999-2003"

... multivariate analysis by Poisson regression* Characters Rate ratio 95% confidence interval for rate ratio Non-Canadian vs Canadian-born 12.27 7.60 to 19.81 Calendar year for non-Canadian-born ... 0.87 to 1.10 Calendar year for Canadian-born children 0.75 0.60 to 0.95 0 to 4 years vs 10 -15 years for Canadian- born children 3.56 1.57 to 8.09 5 to 9 years vs 10 -1...

Ngày tải lên: 02/11/2012, 11:08

4 399 0
w