Báo cáo hóa học: " Dipolar cortico-muscular electrical stimulation: a novel method that enhances motor function in both - normal and spinal cord injured mice" pdf

Báo cáo hóa học: " Dipolar cortico-muscular electrical stimulation: a novel method that enhances motor function in both - normal and spinal cord injured mice" pdf

Báo cáo hóa học: " Dipolar cortico-muscular electrical stimulation: a novel method that enhances motor function in both - normal and spinal cord injured mice" pdf

... 15 RESEA R C H Open Access Dipolar cortico-muscular electrical stimulation: a novel method that enhances motor function in both - normal and spinal cord injured mice Zaghloul Ahmed Abstract Background: ... electrical stimulation: a novel method that enhances motor function in both - normal and spinal cord injured mice...

Ngày tải lên: 19/06/2014, 08:20

15 641 0
Báo cáo hóa học: " The Reflux Disease Questionnaire: a measure for assessment of treatment response in clinical trials" pdf

Báo cáo hóa học: " The Reflux Disease Questionnaire: a measure for assessment of treatment response in clinical trials" pdf

... mild, 2 = moderate, and 3 = severe. Translation and cultural adaptation The RDQ was translated into Norwegian and Swedish according to international principles [10]. The translators met with ... with GERD. Competing interests The authors declare that they have no competing interests. Ola Junghard and Tore Lind are AstraZeneca employees, and Ingela Wiklund was an employee at the ti...

Ngày tải lên: 18/06/2014, 22:20

6 462 0
Báo cáo hóa học: " Testing the potential of a virtual reality neurorehabilitation system during performance of observation, imagery and imitation of motor actions recorded by wireless functional nearinfrared spectroscopy (fNIRS)" potx

Báo cáo hóa học: " Testing the potential of a virtual reality neurorehabilitation system during performance of observation, imagery and imitation of motor actions recorded by wireless functional nearinfrared spectroscopy (fNIRS)" potx

... These networks are activated when individuals learn motor actions via execution (as in traditional motor learning), imitation, observation (as in observational learning) and motor imagery. Activation ... [2 1-2 5,45] that have shown that oxygenation changes can be found within the same s econdary mo tor areas dur ing observa- tion, motor imagery and overt motor executi...

Ngày tải lên: 19/06/2014, 08:20

13 578 0
báo cáo hóa học: " Interleukin-1 receptor 1 knockout has no effect on amyloid deposition in Tg2576 mice and does not alter efficacy following Aβ immunotherapy" pot

báo cáo hóa học: " Interleukin-1 receptor 1 knockout has no effect on amyloid deposition in Tg2576 mice and does not alter efficacy following Aβ immunotherapy" pot

... immunos- tained with anti-mouse CD45 (black stain) in the neo cortex of untreated (A) 9-month-old APP/IL-1 R 1-/ - and (B) 15-month- old APP/IL-1 R 1-/ -; (C) 9-month-old APP/IL-1 R1+ /- and (D) 15-month-old ... Thioflavin-S-stained A plaques (lightly stained areas) decorated with microglia immunostained with anti-Iba1 (brown stain) in the neocortex of untreated (A) 9-month...

Ngày tải lên: 19/06/2014, 22:20

13 411 0
báo cáo hóa học: "Fibrillar beta-amyloid peptide Aβ1–40 activates microglial proliferation via stimulating TNF-α release and H2O2 derived from NADPH oxidase: a cell culture study" doc

báo cáo hóa học: "Fibrillar beta-amyloid peptide Aβ1–40 activates microglial proliferation via stimulating TNF-α release and H2O2 derived from NADPH oxidase: a cell culture study" doc

... accompanied by brain inflammation, characterised by increased cytokine levels and increased numbers of activated microglia [3]. Epidemiological studies have indicated that non-steroidal anti-inflammatory ... characterised by neuritic plaques that contain dead and dying neurons and their processes, inflammatory-activated microglia and β-amyloid peptides A 1–40 and A 1–42 [1,...

Ngày tải lên: 19/06/2014, 22:20

13 388 0
Báo cáo khoa học: Human delta-lactoferrin is a transcription factor that enhances Skp1 (S-phase kinase-associated protein) gene expression pdf

Báo cáo khoa học: Human delta-lactoferrin is a transcription factor that enhances Skp1 (S-phase kinase-associated protein) gene expression pdf

... GCCTCTTTAGAAGTCAATAGTAGG F: CCTACTATTGACTTCTAAAGAGGC S2 S: GCCTCTTTAGAAGATCAAAAGTAGG F: CTACTTTTGATCTTCTAAAGAGGC NS* S: TGGAGCCATCTCTCAGACTTGGG F: CCCAAGTCTAGAGAGATGGCTCCA Delta-lactoferrin enhances Skp1 ... CCCAGTCCCATCCCAGAGGCCATCTCTGGTTTCTTCAGGG DS2 Skp1 S: GTGCTGTTAGCCCTTATTTCCTACTATTAAAGAGGCTTCCATGCCAAACATAGCC F: GGCTATGTTTGGCATGGAAGCCTCTTTAAATAGTAGGAAATAAGGGCTAACAGCAC DLf del.RR S: CT...

Ngày tải lên: 30/03/2014, 08:20

16 364 0
Báo cáo hóa học: " Impacts of selected stimulation patterns on the perception threshold in electrocutaneous stimulation" doc

Báo cáo hóa học: " Impacts of selected stimulation patterns on the perception threshold in electrocutaneous stimulation" doc

... 8:9 http://www.jneuroengrehab.com/content/8/1/9 Page 6 of 10 The PT increased with increasing interleaved time and reached a plateau approximately at the point of 500 μs. The ANOVA analysis indicated a significant ... variable was ‘perception threshold’ in all comparisons. A one-way, repeated analysis of var- iance (ANOVA) was performed and the F-test was used to test if there was...

Ngày tải lên: 19/06/2014, 08:20

10 420 0
báo cáo hóa học:" Preclinical evaluation of dasatinib, a potent Src kinase inhibitor, in melanoma cell lines" pptx

báo cáo hóa học:" Preclinical evaluation of dasatinib, a potent Src kinase inhibitor, in melanoma cell lines" pptx

... K, Cas- taneda S, Cornelius LA, Das J, Doweyko AM, et al.: Discovery of N- (2-chloro-6-methyl-phenyl )-2 -( 6-( 4-( 2-hydroxyethyl)-piper- azin-1-yl )-2 -methylpyrimidin-4-ylamino)thiazole-5-carboxa- mide ... FAK was implicated in dasatinib-mediated inhibition of migration and invasion in melanoma cells. Conclusion: Dasatinib has both anti-proliferative and anti-invasive ef...

Ngày tải lên: 18/06/2014, 15:20

11 477 0
báo cáo hóa học:" Comprehensive molecular etiology analysis of nonsyndromic hearing impairment from typical areas in China" doc

báo cáo hóa học:" Comprehensive molecular etiology analysis of nonsyndromic hearing impairment from typical areas in China" doc

... loss and 200 region- and race-matched controls with normal hearing using a commercially avail- able DNA extraction kit (Watson Biotechnologies Inc, Shanghai, China). Mutational analysis DNA sequence ... The USA and Mongolia. The Molecular Biology of Hearing and Deafness. Bethesda, MD 2001: 4-7 . 59. Yao YG, Salas A, Bravi CM, Bandelt HJ: A reappraisal of complete mtDNA variat...

Ngày tải lên: 18/06/2014, 15:20

12 511 0
báo cáo hóa học:" Circulating endothelial progenitor cells: a new approach to anti-aging medicine?" docx

báo cáo hóa học:" Circulating endothelial progenitor cells: a new approach to anti-aging medicine?" docx

... Nakatsukasa H, Fujiwara K, Hanafusa T, Yumoto Y, Tanimoto T, Kurimoto M, Tanaka N, Tsuji T: Serum gamma-interferon-inducing factor (IL-18) and IL-10 levels in patients with acute hepatitis and ... colony-stimulating factor after acute myocardial infarction: final 1-year results of the Front- Integrated Revascularization and Stem Cell Liberation in Evolving Acute Myocardial Infarctio...

Ngày tải lên: 18/06/2014, 15:20

12 474 0
w