... and training in the National Health Service of United King- dom. Main Reason for migration to United Kingdom and Great BritainFigure 3 Main Reason for migration to United Kingdom and Great Britain. ... CV2 2DX, United Kingdom of Great Britain and Northern Ireland, 4 Tameside General Hospital, Ashton-under-Lyne, OL6 9RW, United Kingdom of...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo sinh học: " Vanishing heat conductivity limit for the 2D Cahn-Hilliard-Boussinesq system" ppt
... corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Vanishing heat conductivity limit for the 2D Cahn-Hilliard-Boussinesq ... original work is properly cited. Vanishing heat conductivity limit for the 2D Cahn-Hilliard-Boussinesq system Zaihong Jiang ∗1 and Jishan Fan 2 1 Dep...
Ngày tải lên: 18/06/2014, 22:20
... in any medium, provided the original work is properly cited. An advanced Bayesian model for the visual tracking of multiple interacting objects Carlos R del Blanco ∗ , Fernando Jaureguizar and ... formatted PDF and full text (HTML) versions will be made available soon. An advanced Bayesian model for the visual tracking of multiple interacting obje...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " Shell Vial culture Assay for the rapid diagnosis of Japanese encephalitis, West Nile and Dengue-2 viral encephalitis" pdf
... Access Research Shell Vial culture Assay for the rapid diagnosis of Japanese encephalitis, West Nile and Dengue-2 viral encephalitis Rangaiah S Jayakeerthi* 1 , Raghava V Potula 1 , S Srinivasan 2 and ... recorded. Standardization of Shell vial culture After adaptation of JE, WN and Dengue-2 viruses (NIV strains) to the porcine kidney cell li...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" Partial vanishing viscosity limit for the 2D Boussinesq system with a slip boundary condition" potx
... acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Partial vanishing viscosity limit for the 2D Boussinesq system with a slip boundary condition Boundary ... distribution, and reproduction in any medium, provided the original work is properly cited. Partial vanishing viscosity limit for the 2D Boussinesq sy...
Ngày tải lên: 21/06/2014, 17:20
Báo cáo sinh học: " A tree-based method for the rapid screening of chemical fingerprints" potx
... fingerprints in the database, and the average query time is presented. Figure 11 Fraction of coefficients calculated, different database size. The fraction of the database for which the Tanimoto coefficient ... bit. In fact we only demand that the data is arranged in some binary tree. The match-bits of a given node are com- puted as all bits that are not a match-bit...
Ngày tải lên: 12/08/2014, 17:20
Báo cáo sinh học: " Jane: a new tool for the cophylogeny reconstruction problem" ppt
... version of Jane. Values of the se parameters were systematically evaluated and the best values found are used as defaults. Jane can import its files in either Tarzan or a Nexus- based format. A file ... implementation of a new software tool, called Jane, for the study of historical associations. This problem arises in parasitology (associations of hosts and parasites), molecu...
Ngày tải lên: 12/08/2014, 17:20
Báo cáo sinh học: " Impact of strong selection for the PrP major gene on genetic variability of four French sheep breeds (Open Access publication)" pptx
... nformation and polymorphisms at microsatellite markers. 664 I. Palhiere et al. Original article Impact of strong selection for the PrP major gene on genetic variability of four French sheep breeds (Open ... The aim of this study was to evaluate the impact of this strong selection on genetic variability. It is focussed on four Frenc...
Ngày tải lên: 14/08/2014, 13:21
Báo cáo sinh học: "Eleven generations of selection for the duration of fertility in the intergeneric crossbreeding of ducks" doc
... according to the egg set rates in 1997 (G6), 2001 (G9) and 2005 (G12) for the S line and in 2005 for the C line. The R 2 were >0.99 indicating the goodness of fit. In the S line (in G12) the fertility ... reproduction technique for mule duck production. Unfortunately, owing to the short duration of fertility in such intergeneric crossbreeding,...
Ngày tải lên: 14/08/2014, 13:21
Báo cáo sinh học: " Genetics Selection Evolution: news for the period " pot
... this article as: Hayes and Boichard: Genetics Selection Evolution: news for the period January 2009 - May 2010 and editorial announcements. Genetics Selection Evolution 2010 42:15. Submit your ... quantitative traits and their evolu- tionary consequences ▪ Mario Calus (Lelystad, The Netherlan ds): sta- tistical and quantitative genetics, QTL detectio n, genomic selection...
Ngày tải lên: 14/08/2014, 13:21
Báo cáo sinh học: "A microsatellite-based analysis for the detection of selection on BTA1 and BTA20 in northern Eurasian cattle (Bos taurus) populations" doc
... 42:32 http://www.gsejournal.org/content/42/1/32 Page 3 of 14 RESEARC H Open Access A microsatellite-based analysis for the detection of selection on BTA1 and BTA20 in northern Eurasian cattle (Bos taurus) populations Meng-Hua Li, ... for the detection of selection on BTA1 and BTA20 in northern Eurasian cattle (Bos taurus) p...
Ngày tải lên: 14/08/2014, 13:21
Báo cáo sinh học: " A new plasmid vector for DNA delivery using lactococci" pptx
... A pCMV ATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGCGTTTAAGCTTAAGCTTGGTACCGA GCTCGGATCCGGGATCCACTAGTCCAGTGTGGTGGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTC GAGTCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGT TTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGA T7 ... sites and polyA site. B A MCS polyA pValac 3742 bp BglII NheI AflII KpnI BamHI SpeI EcoRI...
Ngày tải lên: 14/08/2014, 19:22