báo cáo sinh học:" Is satisfaction a direct predictor of nursing turnover? Modelling the relationship between satisfaction, expressed intention and behaviour in a longitudinal cohort study" pdf

Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx

Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx

... crystallinity rather than adsorption on the enzymatic rate. Thus, the cellulase activity and initial rate data obtained from various samples may provide valuable information about the details of the ... compilation ª 2010 FEBS 1577 Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate Me ´ lanie Hall, Prabuddha Bansal, Jay H. Lee,...

Ngày tải lên: 15/03/2014, 10:20

12 555 0
báo cáo hóa học:" Is there a relationship between factor V Leiden and type 2 diabetes?" doc

báo cáo hóa học:" Is there a relationship between factor V Leiden and type 2 diabetes?" doc

... http://www.translational-medicine.com/content/7/1/ 52 Page 3 of 4 (page number not for citation purposes) Statistical analysis Data are expressed as mean ± standard deviation (SD) or as number and percentage where appropriated. Statistical analysis ... linking between FVL gene variant, diabetes and atherothrombosis and other vascular complications, although data on larger population...

Ngày tải lên: 18/06/2014, 15:20

4 595 0
báo cáo sinh học:" Is satisfaction a direct predictor of nursing turnover? Modelling the relationship between satisfaction, expressed intention and behaviour in a longitudinal cohort study" pdf

báo cáo sinh học:" Is satisfaction a direct predictor of nursing turnover? Modelling the relationship between satisfaction, expressed intention and behaviour in a longitudinal cohort study" pdf

... working as nurses at 3 years. An analysis of NHS Path model of job satisfaction, future intentions and nursing at 18 months and 3 yearsFigure 1 Path model of job satisfaction, future intentions and ... factor analysis was con- ducted in SPSS version 15 on job satisfaction data at 6 and 18 months using principal component analysis with var- imax rotation and Kaiser no...

Ngày tải lên: 18/06/2014, 17:20

12 531 0
báo cáo sinh học:" Training evaluation: a case study of training Iranian health managers" docx

báo cáo sinh học:" Training evaluation: a case study of training Iranian health managers" docx

... level of capability in their job. Then they rated their satisfaction with each technique on a four-point scale (not at all satis- Importance of ways of learning about health planning and managementFigure ... for middle-level health managers [21]. The National Public Health Management Centre (NPMC) was established as a national centre for training and research in health pla...

Ngày tải lên: 18/06/2014, 17:20

14 562 0
báo cáo sinh học:" Migration as a form of workforce attrition: a nine-country study of pharmacists" pptx

báo cáo sinh học:" Migration as a form of workforce attrition: a nine-country study of pharmacists" pptx

... (South Africa) and MEDACT (UK) 19. Labonte R, Packer C, Klassen N: Managing health professional migration from sub-Saharan Africa to Canada: a stakeholder inquiry into policy options. Human Resources ... the national research coordinators: Brooke Myers, Australia; Mamunur Rashid, Bangladesh; Maja Kovacevic, Croatia; Mohammed Atef Abd El Hakim, Egypt; Suresh Panthee and Ganesh Subedi, N...

Ngày tải lên: 18/06/2014, 17:20

10 385 0
báo cáo sinh học:" Experience with a "social model" of capacity building: the Peoples-uni" ppt

báo cáo sinh học:" Experience with a "social model" of capacity building: the Peoples-uni" ppt

... improve the capacity of their own employees or of those who will pay them to provide an educational programme of some sort. A variant of the self-learn model can be found as part of the third ... plan the initiative. After the creation of a charitable trust in the United Kingdom, some of these colleagues became trustees, and others became members of an intern...

Ngày tải lên: 18/06/2014, 17:20

5 446 0
Báo cáo sinh học: "Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor de-differentiation" doc

Báo cáo sinh học: "Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor de-differentiation" doc

... follows: AURKA.FW: GAGATTTTGGGTGGTCAGTAGATG, AURKA.RW: TAGTCCAGCGTGCCACAGAGA, ESD.FW:TGTTGTC ATTGCTCCAGATACCA, ESD.RW:CCCAGCTCTCAT CTTCACCTTT, POLR2B.FW:CCTGATCATAACCAG TCCCCTAGA,OLR2B.RW:GTAAACTCCCATAGCCT GCTTACC. Melting ... 9:100 http://www.translational-medicine.com/content/9/1/100 Page 2 of 6 RESEARCH Open Access Aurora Kinase A expression is associated with lung cancer...

Ngày tải lên: 18/06/2014, 19:20

6 303 0
Báo cáo sinh học: " Research Article Multiple Positive Solutions of Fourth-Order Impulsive Differential Equations with Integral Boundary Conditions and One-Dimensional p-Laplacian" ppt

Báo cáo sinh học: " Research Article Multiple Positive Solutions of Fourth-Order Impulsive Differential Equations with Integral Boundary Conditions and One-Dimensional p-Laplacian" ppt

... Corporation Boundary Value Problems Volume 2011, Article ID 654871, 26 pages doi:10.1155/2011/654871 Research Article Multiple Positive Solutions of Fourth-Order Impulsive Differential Equations with Integral Boundary ... this paper investigates the existence of positive solutions for a class of fourth-order impulsive boundary value problems with...

Ngày tải lên: 21/06/2014, 16:20

26 411 0
Báo cáo sinh học: " Research Article A Multifactor Extension of Linear Discriminant Analysis for Face Recognition under Varying Pose and Illumination" pdf

Báo cáo sinh học: " Research Article A Multifactor Extension of Linear Discriminant Analysis for Face Recognition under Varying Pose and Illumination" pdf

... multiple varying factors. In this paper, we separately address the advantages and disadvantages of multifactor analysis and discriminant anal- ysis and propose Multifactor Discriminant Analysis (MDA) by ... subspace algorithm [12] and a direct L DA algorithm [13], were proposed. 3. Limitat i ons of Multifactor Analysis and Discriminant Analysis LDA and...

Ngày tải lên: 21/06/2014, 16:20

11 313 0
Báo cáo sinh học: "Imp-L2, a putative homolog of vertebrate IGF-binding protein 7, counteracts insulin signaling in Drosophila and is essential for starvation resistance" ppt

Báo cáo sinh học: "Imp-L2, a putative homolog of vertebrate IGF-binding protein 7, counteracts insulin signaling in Drosophila and is essential for starvation resistance" ppt

... functional characterization of an insulin- binding protein in invertebrates. We have identified Imp-L2 as a secreted antagonist of IIS in Drosophila. Given the sequence homology of their Ig domains, ... genetic analyses of IIS in Drosophila and Caenorhabditis elegans have not revealed a functional insulin- binding protein so far. Here, we report the identification...

Ngày tải lên: 06/08/2014, 18:21

11 346 0
Báo cáo y học: " Is eosinopenia a reliable marker of sepsis" pps

Báo cáo y học: " Is eosinopenia a reliable marker of sepsis" pps

... only for the diagnosis of infection but also as a marker of severity of organ dysfunction in sepsis [4]. Authors’ response Khalid Abidi, Ibtissam Khoudri, Jihane Belayachi, Naoufel Madani, Amine ... Zekraoui A, Zeggwagh AA, Abouqal R: Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units. Crit Care 2008, 12:R59. 2. Gil H, Magy N, Mauny...

Ngày tải lên: 13/08/2014, 16:20

2 235 0
Báo cáo y học: " Is there a protective effect of normal to high intellectual function on mental health in children with chronic illness" docx

Báo cáo y học: " Is there a protective effect of normal to high intellectual function on mental health in children with chronic illness" docx

... identification of risk and protective factors is important to improve treat- ment and preventive efforts. Intellectual function (IQ) is a factor that is known to haveaconsiderableeffectonachild’smentalhealth. First ... Hysing 2† Abstract Background: High intellectual function is considered as a protective factor for children s mental health. Few studies hav...

Ngày tải lên: 13/08/2014, 18:21

8 369 0
Báo cáo y học: "Ischemia as a possible effect of increased intraabdominal pressure on central nervous system cytokines, lactate and perfusion pressures" ppsx

Báo cáo y học: "Ischemia as a possible effect of increased intraabdominal pressure on central nervous system cytokines, lactate and perfusion pressures" ppsx

... intra- abdominal pressure on central nervous system cytokines, lactate and perfusion pressures Athanasios Marinis 1* , Eriphili Argyra 2 , Pavlos Lykoudis 1 , Paraskevas Brestas 1 , Kassiani ... to compensatory tachycardia, followed by an increase in CPP and SPP and a decrease of cytokines and lactate. Conclusions: IAH resulted in a decrease of CPP and SPP...

Ngày tải lên: 13/08/2014, 20:21

10 584 0
Báo cáo y học: "MicroRNAs show a wide diversity of expression profiles in the developing and mature central nervous system" docx

Báo cáo y học: "MicroRNAs show a wide diversity of expression profiles in the developing and mature central nervous system" docx

... expression in such cases. Neuroanatomical annotation Annotation of brain areas was made according to the atlases available for the embryonic and adult zebrafish [63,64] and available anatomical literature ... Addi- tional data file 5), optic tectum as well as novel areas of the dorsal hindbrain (cerebellar granular layer, facial and vagal lobes; Additional data file 5, an...

Ngày tải lên: 14/08/2014, 08:20

16 406 0
Báo cáo sinh học: "Is gene therapy a good therapeutic approach for HIV-positive patients?" pot

Báo cáo sinh học: "Is gene therapy a good therapeutic approach for HIV-positive patients?" pot

... suicide genes was made popular as a potential approach for treat- ing cancer. As an anti-HIV strategy this method was tried in vitro as proof-of-concept in a study that used a retrovi- rus to transduce ... sequences to a target RNA. It pairs with the target RNA forming a double-stranded RNA structure that either blocks translation or becomes a target for degradation in the c...

Ngày tải lên: 14/08/2014, 19:22

9 440 0
w