calcium binding protein protocols volume 1

calcium binding protein protocols volume 1

calcium binding protein protocols volume 1

... Shaw xi 15 Proteolytic Fragments of Calcium- Binding Proteins Richard D. Brokx and Hans J. Vogel 16 Electron Magnetic Resonance Studies of Calcium- Binding Proteins Lawrence J. Berliner 17 Cadmium -11 3 ... Protocols Edited by Hans J. Vogel VOLUME 17 2 Volume I Reviews and Case Studies Edited by Hans J. Vogel Volume I Reviews and Case Studies Calcium- Binding Protein P...

Ngày tải lên: 11/04/2014, 00:24

357 252 0
calcium-binding protein protocols volume 2

calcium-binding protein protocols volume 2

... Molecular Biology TM Calcium- Binding Protein Protocols Edited by Hans J. Vogel VOLUME 17 3 Volume II Methods and Techniques Edited by Hans J. Vogel Calcium- Binding Protein Protocols Volume II Methods ... Berliner 19 5 17 Cadmium -11 3 and Lead-207 NMR Spectroscopic Studies of Calcium- Binding Proteins Teresa E. Clarke and Hans J. Vogel 205 18 Calcium- 43 of NM...

Ngày tải lên: 11/04/2014, 00:23

435 400 0
Báo cáo Y học: Structural and biochemical characterization of calhepatin, an S100-like calcium-binding protein from the liver of lungfish (Lepidosiren paradoxa) docx

Báo cáo Y học: Structural and biochemical characterization of calhepatin, an S100-like calcium-binding protein from the liver of lungfish (Lepidosiren paradoxa) docx

... Sci. 16 , 98 10 3. 2. Donato, R. (19 99) Functional roles of S100 proteins, calcium- binding proteins of the EF-hand type. Biochim. Biophys. Acta 14 50, 19 1–2 31. 3. Kligman, D. & Hilt, D.C. (19 88) ... Junı ´ n 956, Buenos Aires (11 13), Argentina. Fax: + 54 11 4508 3652, Tel.: + 54 11 4508 36 51, E-mail: santome@qb.ffyb.uba.ar Abbreviations: CaBP, calcium- binding protein;...

Ngày tải lên: 08/03/2014, 22:20

9 446 0
Báo cáo khoa học: Conformational and functional analysis of the lipid binding protein Ag-NPA-1 from the parasitic nematode Ascaridia galli potx

Báo cáo khoa học: Conformational and functional analysis of the lipid binding protein Ag-NPA-1 from the parasitic nematode Ascaridia galli potx

... Sofia 17 56, Bulgaria Fax: +359 286 210 59 Tel: +359 28626036/ 210 E-mail: r.boteva@ncrrp.org (Received 27 July 2004, revised 17 September 2004, accepted 20 September 2004) doi :10 .11 11/ j .14 32 -10 33.2004.04398.x Ag-NPA -1 ... Trp residue of the 0.00 0.05 0 .10 0 .15 1. 0 1. 1 1. 2 1. 3 [acrylamide] M F 0 /F Fig. 3. Quenching of Trp fluorescence of Ag-NPA -1 by acrylamide. A valu...

Ngày tải lên: 16/03/2014, 18:20

10 506 0
Báo cáo khoa học: Solution structure and internal dynamics of NSCP, a compact calcium-binding protein doc

Báo cáo khoa học: Solution structure and internal dynamics of NSCP, a compact calcium-binding protein doc

... (°) NSCP a (NMR) NSCP b (X-ray) BlSCP c (X-ray) SeCaBP d (NMR) Calmodulin e (X-ray) A ⁄ B67±4 60 59 78 89 C ⁄ D 69 ± 6* 84* 82 10 1* 89 E ⁄ F 10 8 ± 5 11 0 11 1 10 7 10 1 G ⁄ H 10 1 ± 3 10 0 96* 11 3 95 a This work, mean ± SD over the 17 molecule ensemble. b [6], 2SCP.pdb. c B. lanceolatum ... (A ˚ ) Residues 3 15 , 22–37, 46–57, 69–82, 89 10 2, 11 0 12 2, 12 9 13 7, 14 4 15 9 a...

Ngày tải lên: 23/03/2014, 13:20

15 294 0
Báo cáo khoa học: What determines the degree of compactness of a calcium-binding protein? pdf

Báo cáo khoa học: What determines the degree of compactness of a calcium-binding protein? pdf

... 0.003 1 2 0 2 90 10 2 17 7 13 7.34 1DGU 17 0 )9 )1 )10 0 0.052 )0.404 0 0 0 2 93–97 19 1 5 2.62 Unknown structures HsCen1 18 1 )11 0 )10 11 0.058 1. 713 0 0 0 0 99 10 3 17 2 5 2. 91 MmCen1 19 1 )11 0 )10 ... 0 96 10 0 16 9 5 2.96 CrCen 26 ) 1 )11 0 )12 11 0.0 71 1.749 0 1 0 0 96 10 0 16 9 5 2.96 TsCen 27 )7 )10 0 )17 70 0 .11 5 1. 760 0 1 0 0 75–79 14 8 5 3.38 SdC...

Ngày tải lên: 30/03/2014, 02:20

12 370 0
germ cell protocols, volume 1

germ cell protocols, volume 1

... Biol. Cell 40, 11 9 12 8. 13 . Maier, I. and Müller, D. G. (19 86) Sexual pheromones in algae. Biol. Bull. 17 0, 14 5 17 5. 14 . Olson, J. H., Xiang, X., Ziegert, T., et al. (20 01) Allurin, a 21- kDa sperm chemoattractant ... egg jelly, is related to mammalian sperm -binding proteins. Proc. Natl. Acad. Sci. USA 98, 11 ,205 11 , 210 . 15 . Cosson, J., Carré, D., and Cosson, M. P. (19...

Ngày tải lên: 11/04/2014, 09:43

305 367 0
hepatitis b and d protocols volume 1

hepatitis b and d protocols volume 1

... AATTTATGCCTACAGCCTCC 10 . 16 78 + ACCAGCACCATGCAACTTTT 11 . 16 83 a (T) 15 GCTGG 12 . 17 52 + GTGCCTTGGGTGGCTTTAGGGCATGGACAT 13 . 18 06 a (T) 15 AGCTC 14 . 18 08 a (T) 15 GAAGC 15 . 18 24 − AGAGAGTAACTCCACAGAAG a Oligonucleotides ... no. 11 750 41) . 10 . Taq DNA polymerase (Invitrogen, cat. no. 18 038- 018 ). 11 .Titan One Tube RT/PCR System (Roche, cat. no. 18 55476)....

Ngày tải lên: 11/04/2014, 09:45

333 406 0
Báo cáo khoa học: NBR1 interacts with fasciculation and elongation protein zeta-1 (FEZ1) and calcium and integrin binding protein (CIB) and shows developmentally restricted expression in the neural tube pptx

Báo cáo khoa học: NBR1 interacts with fasciculation and elongation protein zeta-1 (FEZ1) and calcium and integrin binding protein (CIB) and shows developmentally restricted expression in the neural tube pptx

... and F EZ1 as interacting partners of NBR1. HF7c cells were cotransformed w ith either pACT2FEZ1 (Y 214 ), pACT2FEZ1 (Y156), pACT2FEZ1 (Y163), pACT2CIB (Y198) or pGAD424NBR1 and (i) pGBT9NBR1 (ii) ... BR1 cDNA were PCR a mpli®ed and subcloned into the pGBT9 vector EcoRI site to give the following constructs: pGBT9NBR1 216 (amino acids 1 216 ), pGBT9NBR1 333 (amino acids 1 333), pGBT9NBR1c1...

Ngày tải lên: 08/03/2014, 10:20

8 426 0
Tài liệu Báo cáo khoa học: Structure of the putative 32 kDa myrosinase-binding protein from Arabidopsis (At3g16450.1) determined by SAIL-NMR docx

Tài liệu Báo cáo khoa học: Structure of the putative 32 kDa myrosinase-binding protein from Arabidopsis (At3g16450.1) determined by SAIL-NMR docx

... 210 .1) N-glycan Galb1-4GlcNAcb1-2Mana1-6 (Galb1-4GlcNAcb1-2 Mana1-3)Manb1-4GlcNAcb1-4(Fuca1-6) GlcNAc (code no. 210 .4) N-glycan GlcNAcb1-2Mana1-6(GlcNAcb1-2Mana1-3) Manb1-4(Xylb1-2)GlcNAcb1-4 (Fuca1-3)GlcNAc ... PA-oligosaccharides, GalNAca1-3(Fuca1-2)Galb1-3(Fuca1-4)GlcNAcb1-3Galb1- 4Glc-PA and Neu5Aca2-6Galb1-4GlcNAcb1-2Mana1- 6(Neu5Aca2-3Galb1-3(Neu5Aca2-6)GlcNAcb1-4(Neu5Aca2- 6Galb1-4G...

Ngày tải lên: 18/02/2014, 14:20

12 581 0
w