nuallain - the search for mind - a new foundation for cognitive science (cromwell, 2002)
... many Forms are there? Is there a Form for a CS text? We see this issue again in AI. The materialist/dualist war (it has all the characteristics thereof) is essentially part of Plato’s heritage. ... Surely there is an easier way to approach the apparently natural study of language than to discuss a discipline whose stated mission of supplying a formalization of language has led...
Ngày tải lên: 03/04/2014, 12:07
... Jeff Staniforth, the creator of Sculptor 3, an amazing software that can make affirmations work for anyone, has this to say about affirmations: “By definition, an affirmation is a statement ... creation. Whether you create a new object or a new you, the process is always the same. Whatever it is that you want to achieve in life, these are the steps you need to tr...
Ngày tải lên: 15/12/2013, 06:15
... in the last two to three years has it gained a lot of exposure in industry and the media. The main reason for this is that the VR technology has become available at an affordable ... particular, a VR-based application is compared to a typical three-dimensional (3D) computer- aided-design (CAD) application to highlight the similarities and differenc...
Ngày tải lên: 23/01/2014, 07:20
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the ... follows: anti-PECAM-1 (BD Pharmingen, Franklin Lakes, NJ, USA), anti-Lyve-1 (R&D, Minneapolis, MN, USA), anti-Prox-1 (Acris Antibodies, Hiddenhausen, Germany), and anti-SV40 T Ag (San...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo khoa học: "Parsing the Internal Structure of Words: A New Paradigm for Chinese Word Segmentation" doc
... this accuracy. Besides, the result for flat labels compares favorably with the state of the art accuracy of about 93% F 1 for joint word segmen- tation and part-of-speech tagging (Jiang et al., ... Kiat Low. 2004. Chinese part-of- speech tagging: One-at -a- time or all-at-once? word- based or character-based? In Dekang Lin and Dekai Wu, editors, Proceedings of EMNLP 2004, pages 277–...
Ngày tải lên: 17/03/2014, 00:20
BAMBOO AS A NEW FIBER SOURCE IN THE US PAPER INDUSTRY: A FEASIBILITY ANALYSIS FOR BOOSHOOT GARDENS, LLC docx
... as well as hardened targets, but the business must also stay at the new destination long enough to reap rewards for having the journey. And it has to do all this in a way that ... about the company. A feasibility study starts with an analysis of the current situation. I started with a SWOT analysis to assess the strengths and weaknesses of the...
Ngày tải lên: 18/03/2014, 02:20
Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc
... that directly upstream of P HOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG GCCG-3¢ and 5¢ -ATCTTTCAAATAGAGCCTGG-3¢). The amplified DNA fragments were used to transform BFG2Z18-K3 5A, ... candidates was amplified by PCR using primers 5¢-AAATATAAAACGCTAGCGTCGACATGGC GC-3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3 ¢. The final ratio of target cells was determined by the numb...
Ngày tải lên: 22/03/2014, 21:20
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"
... of rasburicase, at low dosage, has showed a rapid reduction of hyperurice- mia. [2 1-2 4] Contemporary use of alkalinization, hy- dration and rasburicase at 0.10 mg/kg for 3-5 days maintains the ... and alkalinization, associ- ated with an aggressive hydration. Rasburicase pre- sents various features that give it a more favourable profile than standard drugs used for TLS. Th...
Ngày tải lên: 31/10/2012, 14:59
A new algorithm for enumeration of minimum cutsets of graph by branch addition
... in Table 2. The calculations have made by Matlab version 6.5. The cutsets of this graph have calculated in 0.8 second. This algorithm also has applied to a part of Iran transmission and subtransmission ... ''Generating capacity reliability evaluation in interconnected systems using a frequency and duration approach, Part I: Mathematical analysis,'' IEEE Trans...
Ngày tải lên: 03/01/2014, 19:35