Báo cáo Y học: Arginine 121 is a crucial residue for the specific cytotoxic activity of the ribotoxin a-sarcin potx

Báo cáo y học: "Repetitive DNA is associated with centromeric domains in Trypanosoma brucei but not Trypanosoma cruzi" pot

Báo cáo y học: "Repetitive DNA is associated with centromeric domains in Trypanosoma brucei but not Trypanosoma cruzi" pot

... ATGCAATATGTAAGGTGTTTT-GGTGTAAAACACGCATTCTTG-CATAACATGCACAATG 58 Tb11 ATGCAATATGTAAGGTGTTTT-GGTGTAAAACACGCATTCTTG-CATAACATGCACAATG 58 Tb4 ATGCAATATGTAAGGTGTTTT-GGTGCAAAACACGCATTCTTG-CATAACATGCACAATG 58 Tb9 ATGCAATATGTAAGGTGTTTT-GGTGCAAAACACGCATTCTTG-CATAACATGCACAATG ... GTGTTATTAAGTGTTTTATGTGAAAAAGCGTGTTAT 36 Tb1 ATGCGCAATAATACGCAATAATACGCAAT-AATGCGCAATAATGCACA 47 Tb6 ATGTGCAATAATGTGCAATTATATG...

Ngày tải lên: 14/08/2014, 20:22

14 297 0
Báo cáo y học: "Anni 2.0: a multipurpose text-mining tool for the life sciences" ppt

Báo cáo y học: "Anni 2.0: a multipurpose text-mining tool for the life sciences" ppt

... transformation and tumorigenesis. Science 1999, 285:418-422. 36. Honda K, Mihara H, Kato Y, Yamaguchi A, Tanaka H, Yasuda H, Furu- kawa K, Urano T: Degradation of human Aurora2 protein kinase by the ... association in a concept profile can be traced to the sup- porting documents. Results Use case 1: analysis of a DNA microarray dataset For this use case we applied Anni 2.0 to analyze a set of...

Ngày tải lên: 14/08/2014, 08:21

10 343 0
Báo cáo y học: "Translational control plays a prominent role in the hepatocytic differentiation of HepaRG liver progenitor cells" docx

Báo cáo y học: "Translational control plays a prominent role in the hepatocytic differentiation of HepaRG liver progenitor cells" docx

... for the gift of the HepaRG cells We also thank Deepak Kolippakkam and Neha Lohia for assistance in data analysis and Paul Farley for assistance in the preparation of the manuscript ... RX, Tachibana K, Watanabe Y, Uchiyama Y, Sumi K, Iguchi H, Ito S, Doi T, Hamakubo T, Naito M, Auwerx J, Yanagisawa M, Kodama T, Sakai J: Activation of peroxisome proliferator-activated receptor ... plotted agai...

Ngày tải lên: 14/08/2014, 08:20

14 386 0
Báo cáo y học: ": Combined analysis reveals a core set of cycling genes" pdf

Báo cáo y học: ": Combined analysis reveals a core set of cycling genes" pdf

... between the genes They allow for one to many and for many to many mappings between genes; they also allow higher quality expression data in one species to improve the quality of the data for other ... performed this analysis separately for each species and then looked at the overlap Our method overcomes many of the obstacles discussed above We use the same scoring method for all species, and...

Ngày tải lên: 14/08/2014, 08:20

12 220 0
Báo cáo y học: " Endothelial Postresuscitation care with mild therapeutic hypothermia and coronary intervention after out-of-hospital cardiopulmonary resuscitation: a prospective registry analysi" pot

Báo cáo y học: " Endothelial Postresuscitation care with mild therapeutic hypothermia and coronary intervention after out-of-hospital cardiopulmonary resuscitation: a prospective registry analysi" pot

... T, Daya M, Nishiuchi T, Hayashi Y, Kitamura T, Irisawa T, Sakai T, Kuwagata Y, Hiraide A, Kishi M, Yamayoshi S: Impact of transport to critical care medical centers on outcomes after out-of-hospital ... data quality. The GRR is currently the largest resuscitation registry launched in Germany. The dataset was approved by the German Society of Cardiologists and Internal Medicine. The registry w...

Ngày tải lên: 14/08/2014, 07:21

10 365 0
Báo cáo y học: " Memory in astrocytes: a hypothesis" doc

Báo cáo y học: " Memory in astrocytes: a hypothesis" doc

... but is stored as an organization of the activity of the ion channels. Further analysis of two dimensional cellular automata also demonstrates that these systems have both associative and temporal ... that the cellular automata stored information and the number of units in the automata. This indicated that the addition of units to the automata exponentially increased the amount of time the aut...

Ngày tải lên: 13/08/2014, 23:20

10 174 0
Báo cáo y học: "Nucleic acid chaperons: a theory of an RNA-assisted protein folding" ppt

Báo cáo y học: "Nucleic acid chaperons: a theory of an RNA-assisted protein folding" ppt

... macromolecular families, does not automatically mean that they are functionally related to each other (or that one is a chaperon), but it is a widely accepted sign of a biologically significant relationship. ... folding pathways with different end- points, only one of which is physiologically normal. Rather, the problem is the risk of deviation from the (physiological) folding pathway to form...

Ngày tải lên: 13/08/2014, 23:20

11 237 0
Báo cáo y học: " Nebulized heparin is associated with fewer days of mechanical ventilation in critically ill patients: a randomized controlled trial" potx

Báo cáo y học: " Nebulized heparin is associated with fewer days of mechanical ventilation in critically ill patients: a randomized controlled trial" potx

... exacerba- tion of chronic obstructive airway disease, or other acute lung disorder. Statistical analysis On the basis of previous data from a trial of intravenous heparin to limit lung injury ... Victoria, 3065, Australia. Authors’ contributions BD and RS participated in the study design, data gathering, interpretation, statistical analysis, and writing the first draft and all revisions of th...

Ngày tải lên: 13/08/2014, 21:21

10 611 0
Báo cáo y học: "Cerebral microcirculation is impaired during sepsis: an experimental study" pdf

Báo cáo y học: "Cerebral microcirculation is impaired during sepsis: an experimental study" pdf

... Institute of Laboratory Animal Resources and National Research Council. Guide for the Care and Use of Laboratory Animals Washington: National Academy Press 1996. 31. Dubois EF: The estimation of the ... hourly. Thoracopulmonary compliance was calculated using a standard formula. Arterial samples were obtained at baseline and then hourly after feces spillage. The total amount of blood withdraw...

Ngày tải lên: 13/08/2014, 21:21

10 272 0
Báo cáo y học: "Risk factors in critical illness myopathy during the early course of critical illness: a prospective observational study" pot

Báo cáo y học: "Risk factors in critical illness myopathy during the early course of critical illness: a prospective observational study" pot

... measurements and analysis FB programmed the data base and partici- Page 11 of 12 pated in data collection and analysis KW prepared the statistical part of the manuscript and performed the statistical analysis ... analysis CS critically revised the manuscript and gave final approval SS critically revised the electrophysiological data analysis and participated in writing the paper All authors r...

Ngày tải lên: 13/08/2014, 20:22

12 275 0
Báo cáo y học: "Brain metabolism is significantly impaired at blood glucose below 6 mM and brain glucose below 1 mM in patients with severe traumatic brain injury" pptx

Báo cáo y học: "Brain metabolism is significantly impaired at blood glucose below 6 mM and brain glucose below 1 mM in patients with severe traumatic brain injury" pptx

... the data, performed graphical and statistical analysis, and drafted parts of the manuscript All authors have read and approved the final manuscript Page 11 of 13 Acknowledgements The help of the ... requirements Microdialysis and blood glucose analysis Extracellular brain glucose, lactate, pyruvate, and glutamate were determined by microdialysis For this, the intracerebral CMA 70 bolt cathete...

Ngày tải lên: 13/08/2014, 20:21

13 257 0
Báo cáo y học: " Research How is the balance between protein synthesis and degradation achieved" ppt

Báo cáo y học: " Research How is the balance between protein synthesis and degradation achieved" ppt

... University of California, San Francisco, San Francisco, CA 94143, USA Full list of author information is available at the end of the article Rothman Theoretical Biology and Medical Modelling ... true as the assumption that the synthesis and degradation of proteins are equal at the steady state, as with any theoretical conclusion experimental validation is important. As such, we should ask ......

Ngày tải lên: 13/08/2014, 16:20

11 307 0
Báo cáo y học: "Networked Research buffering: a basic mechanism for distributed robustness in complex adaptive systems" pptx

Báo cáo y học: "Networked Research buffering: a basic mechanism for distributed robustness in complex adaptive systems" pptx

... what we call 'pure redundancy' or simply 'redundancy': purely redundant agents are always functionally identical in either neither or across both of the task types they can perform In all other ... functions may overlap with a particular set of agents in the system, another of its functions may overlap with an entirely distinct set of agents Thus functionally related agents can have additiona...

Ngày tải lên: 13/08/2014, 16:20

20 199 0
Báo cáo y học: "Research Saturation Behavior: a general relationship described by a simple second-order differential equation" ppt

Báo cáo y học: "Research Saturation Behavior: a general relationship described by a simple second-order differential equation" ppt

... this relation, based solely on the analysis of the typical experimental data plot and its saturation characteristics. Its utility complements the traditional empirical approaches. Results: For ... equation is then integrated and applied to illustrative examples. Results Basic saturation behavior case The general nature of the initial extensive mathematical analysis suggests using familiar mat...

Ngày tải lên: 13/08/2014, 16:20

13 149 0
Báo cáo y học: " Chinese medicines as a resource for liver fibrosis treatment" ppsx

Báo cáo y học: " Chinese medicines as a resource for liver fibrosis treatment" ppsx

... 51:603-9. 26. Rino Y, Tarao K, Morinaga S, Ohkawa S, Miyakawa K, Hirokawa S, Masaki T, Tarao N, Yukawa N, Saeki H, Takanashi Y, Imada T: Reduc- tion therapy of alanine aminotransferase levels prevent ... enzymes, i.e. aspar- tate transaminase (AST) and alanine transaminase (ALT). A study with multivariate analysis demonstrates that the mode of therapy and ALT levels are significant factors af...

Ngày tải lên: 13/08/2014, 15:21

11 430 0
Từ khóa:
w