Báo cáo khoa học: "Interactive Discourse: Looking t o the Future Panel " pptx

Báo cáo khoa học: "Interactive Discourse: Looking t o the Future Panel " pptx

Báo cáo khoa học: "Interactive Discourse: Looking t o the Future Panel " pptx

... the crewmen Bowman and Poole are engrossed in a fading vision screen image of Poole's family on Earth, on the occasion of Poole's birthday. "Sorrv to interrupt the festivities," ... Interactive Discourse: Looking to the Future Panel Chair's Introduction Bonnie Lynn Webber University of Pennsylvania In any technological field, both short-term an...

Ngày tải lên: 31/03/2014, 17:20

2 196 0
Báo cáo khoa học: "Interactive Discourse: Influence of Problem Context " potx

Báo cáo khoa học: "Interactive Discourse: Influence of Problem Context " potx

... computer system to take into account the effects of this context (and, yes, even whether that is possible). My hope is that those on the panel who are concerned with the construction of computer-based ... language to this question. My hope is that looking at the question from these different perspectives will ex- pose issues critical to the study of language in gener- al,...

Ngày tải lên: 17/03/2014, 19:20

2 277 0
Báo cáo khoa học: "Interactive Discourse: Influence of the Social Context " pot

Báo cáo khoa học: "Interactive Discourse: Influence of the Social Context " pot

... coherent view of what the role is. The linguistic competence of the system is an important element of the image it conveys to the user [2]. 3. When we move from face-to-face conversations to dialogs ... capabilities than to ease the interaction. What the system does, via lexical choice, indirect speech acts, polite forms, etc., to maintain its role in the inter- actio...

Ngày tải lên: 24/03/2014, 01:21

2 308 0
Báo cáo khoa học: "Hierarchical Bayesian Language Modelling for the Linguistically Informed" pptx

Báo cáo khoa học: "Hierarchical Bayesian Language Modelling for the Linguistically Informed" pptx

... designates the head component. Following the motivation in §3.1, I set up the model to generate the head component c Λ 1 condi- tioned on the word context u, while the remaining components ˜w ... Experiments The aim of the experiments reported here is to test whether the richer account of compounds in the proposed language models has positive effects on the predictabilit...

Ngày tải lên: 24/03/2014, 03:20

10 351 0
Báo cáo khoa học: "WHAT DISCOURSE FEATURES AREN''''T NEEDED IN ON-LINE DIALOGUE" docx

Báo cáo khoa học: "WHAT DISCOURSE FEATURES AREN''''T NEEDED IN ON-LINE DIALOGUE" docx

... framework, but it cannot provide the kind of context that comes from being a participant in social life, nor a validation of another's perception, except to the extent that matters of "fact" ... this, but all do it. To the extent that they don&apos ;t do it, they risk being in- appropriate and not getting rewards from interaction. (see F. Erickson for a study of th...

Ngày tải lên: 31/03/2014, 17:20

4 254 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... as above to obtain the complete 3¢-UTR of zebrafish stat6. The PCR products obtained were ligated into the pGEM -T Easy vector (Promega). Following transfection into competent E. coli cells (ActifMotif, ... PCR Zfstat6-F2 TGTCAGTCCTCTTTAATGCT Initial PCR Zfstat6-R2 AATGGTATCCTGTTTGGCTCAG Initial PCR Zf3¢stat6-F1 GGTTGTAATTGTACACGGTAGTC 3¢-RACE Zf3¢stat6-F2 CGGTAGTCAGGAAATCAATGCC 3¢-RACE...

Ngày tải lên: 16/02/2014, 09:20

20 691 0
Tài liệu Báo cáo khoa học: "Unsupervised Discourse Segmentation of Documents with Inherently Parallel Structure" pdf

Tài liệu Báo cáo khoa học: "Unsupervised Discourse Segmentation of Documents with Inherently Parallel Structure" pdf

... alignment to find their best alignment to the segments of the story. Our model We evaluate our joint model of seg- mentation and alignment both with and without the split/merge moves. For the model ... induce segmentations at different levels of granularity on both the story and the lecture side. However, given that the segmentation of the story was obtained by an automatic sen...

Ngày tải lên: 20/02/2014, 04:20

5 377 0
Tài liệu Báo cáo khoa học: "Interactive ASR Error Correction for Touchscreen Devices" docx

Tài liệu Báo cáo khoa học: "Interactive ASR Error Correction for Touchscreen Devices" docx

... presented with the decoding result in a large font, either in a window on the desktop, or in a full-screen presentation on a touchscreen device. If the utterance is too long to t on the screen, the ... apart” regions of the hypothesis to reveal a cloud of words simlar to the “tag clouds” popular in many Web applications. This interface is potentially useful for dicta- tion on p...

Ngày tải lên: 20/02/2014, 09:20

3 282 0
Tài liệu Báo cáo khoa học: "Interactive Multi-Document Summarization" docx

Tài liệu Báo cáo khoa học: "Interactive Multi-Document Summarization" docx

... com- ponents: Content Selection The goal of content selection is to identify important concepts mentioned in a document collection. NeATS computes the likelihood ratio (Dunning, 1993) to identify ... into three parts corresponding to the three directions outlined in Section 1. The control panel displays the summarization parame- ters on the left side of the screen. The docum...

Ngày tải lên: 20/02/2014, 16:20

4 335 0
Tài liệu Báo cáo khoa học: Structure of peptidase T from Salmonella typhimurium doc

Tài liệu Báo cáo khoa học: Structure of peptidase T from Salmonella typhimurium doc

... l ow occupancy of the second zinc site or to the limited resolution of the data. Superimposition o f the two m etal ions and t he Ca atoms o f the ®ve ligand amino-acids of p eptidase T a nd the ... ctivator that re sponds to anaero- biosis [4,5]. The aerobic expression level of peptidase T is not suf®cient to allow this enzyme to contribute to the utilization of exo...

Ngày tải lên: 21/02/2014, 03:20

8 396 0
w