Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot

... canopy, Boundary‐LayerMeteorology102(2002)459.   VNUJournal of Science,EarthSciences23(2007)160‐169 160 A numerical model for the simulation of wave dynamics  in the surf zone and near coastal structures VuThanhCa* Center for Marine and Ocean-Atmosphere Interaction Research, Vietnam Institute ... the wave dynamics in the near shore area and in the vicin...

Ngày tải lên: 28/03/2014, 15:20

... constants corresponding to apparent rate constants are obtained by fitting Eqn (1): DAbs ¼ a þ b e Àct ð1Þ where, DAbs is the variation of absorbance, a and b are amplitude parameters and c is the ... each containing a low-potential and a high-potential [Fe-S]. Thus each structural domain of b may be a transfer unit for the electron transfer pathway in this enzyme...

Ngày tải lên: 07/03/2014, 15:20

... force evaluation. Force-evaluation stage consists of near field and far field evaluation parts. In the case of original FMM, only the near field part of the force-evaluation stage can be performed ... mainly because the hardware limitation. Since dedicated hardware can calculate the particle force only, they cannot handle multipole and local ex- pansions. Therefore o...

Ngày tải lên: 22/03/2014, 11:20

... expression of mutations in the HMBS gene can provide valuable information with respect to the interpretation of clinical, biochemical and genetic data and establishing a diagnosis of AIP. The use of the ... patients. The N-, central and C-domains are shown in silver, blue and green, respectively; the positions of the mutated amino acids are indicated in...

Ngày tải lên: 23/03/2014, 04:21

... P1b, P 2a, P2b, and P2c are Basic-states. P1 and P2 are Or-states and they are two children of And- state P0. At the beginning, the control will reach P0, and then go to P1 and P2 at the same time ... Statecharts. Conceptually, an object remains in a state for an interval of time. However, the semantics allow for modelling to “flow–through” states in an i...

Ngày tải lên: 28/03/2014, 13:20

... proposed for the use of global features for linear models such as (Daum ´ e III and Marcu, 2005; Kazama and Torisawa, 2007). In this work, we use the approach proposed in (Kazama and Torisawa, 2007). ... candidate F P A Plemma and plemma&ppos of the argument candidate Dependency label path between the predicate and the argument candidates F G The sequen...

Ngày tải lên: 30/03/2014, 21:20

... informa- tion. The results indicate that the pK a of the catalytic acid (Glu144) is ÔcycledÕ during catalysis as a consequence of substrate-binding and release and, possibly, by a back and forth movement of ... each reaction (product formation was linear for at least 20 min, at all substrate concentrations, at almost all pH values and for all mutants). In this w...

Ngày tải lên: 07/03/2014, 14:20

... eleph'ants are " ' charglng. The first sentence conveys the information that a group of elephants happen to be perforlaing a certain action, that of charging, whereas the important information ... movement and durational change. Intensity was not included because the software that drove the synthesiser had no facility for user alteration of this p...

Ngày tải lên: 09/03/2014, 01:20

... consequence of evaluation and rejection about pages influence weakly to other pages, the rank score of pages of the original Web graph can be approximated from the rank score of pages in the new partition ... following all outlinks with equal probability and the score of a page is the probability that the random surfer would visit that page. PageRank scores act...

Ngày tải lên: 22/03/2014, 11:20

... lm Taxol did not cause increase of acetylated tubulin (Fig. 1E), indicating that the acetylation state of tubulin depends mainly on the relative activities of the acetylating and deacetylating ... Idem MAP2 -for MAP2-rev GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC 91489–91517 92431–92404 NC_000067 Idem Tau -for Tau-rev GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAG...

Ngày tải lên: 23/03/2014, 05:22