Family and Friend 3 Workbook doc
... x0 y3 w0 h0" alt=""
Ngày tải lên: 24/03/2014, 21:21
... primers and TaqMan probes, were used to quantify the expression of mature miRNA-192 (AB: 437 3108) and miRNA-194 (AB: 437 3106). Gene expression was calculated relative to 18S rRNA (AB: 433 3760F). Acknowledgements This ... GGA TCCGGCAAACAGGTCATAAAAAGACAC; Per3 forw, GAATTCTTAAGTGACTGTGAGGATGAACCTTC; Per3 rev, GGATCCTCACGTTTTACATGTACAGAGTTTA. Luc-Per1 -3 UTR, Luc-Per2 -3 UTR and Luc-Pe...
Ngày tải lên: 18/02/2014, 06:20
Linq and C# 3.0 docx
... between CLR and database world 1. Attributes on CLR types 2. XML mapping file • Table<T> class handles mapping and materialization of objects into context • SqlMetal.exetool and DLinq designer ... DescendantNodes , AncestorNodes , SelfAndDescendantNodes 15 28 JUNI 2006 | © CLASS -A More Linq to XML • Add annotations to the XContainer nodes ( XElement and XDocument ) • D...
Ngày tải lên: 14/03/2014, 20:20
... giving and receiving help in the family and between friends? • Do people feel the same about helping family members and helping friends? • What's the difference between help from family ... be friends with the other members of your family for a long time? • Do you think modern technology such as computers and the cell-phones play a positive role in family relations...
Ngày tải lên: 04/10/2013, 17:20
Tài liệu Lab 4.2.3 Suspending and Disconnecting Telnet Sessions docx
... 1 - 4 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 4.2 .3 Copyright 20 03, Cisco Systems, Inc. Lab 4.2 .3 Suspending and Disconnecting Telnet Sessions Objective ... disconnect and press Enter. Upon completion of the previous steps, logoff by typing exit. Turn the router off. 3 - 4 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 4.2 .3 Copyright 20 03, Cisco ......
Ngày tải lên: 11/12/2013, 14:15