Báo cáo khoa học: Crystal structure of a staphylokinase variant A model for reduced antigenicity pptx

Báo cáo khoa học: Crystal structure of basic 7S globulin, a xyloglucanspecific endo-b-1,4-glucanase inhibitor protein-like protein from soybean lacking inhibitory activity against endo-b-glucanase doc

Báo cáo khoa học: Crystal structure of basic 7S globulin, a xyloglucanspecific endo-b-1,4-glucanase inhibitor protein-like protein from soybean lacking inhibitory activity against endo-b-glucanase doc

... interface was detected with ASV CALCULATOR [34]. ASA was calculated with a program kindly provided by M Maeda (National Institute of Agrobiological Sciences, Japan). DASA (A ˚ 2 ) No. of water ... number 3AUP. Abbreviations ANXY, Aspergillus niger xylanase; ASA, accessible surface area; AUC, analytical ultracentrifugation; BTB, back-to-back; Bg7S, basic 7S globulin; EDGP, extracellular...

Ngày tải lên: 14/03/2014, 23:20

11 526 0
Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt

Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt

... importin -a nuclear import pathway, provided that CLIC4 can undergo a conforma- tional rearrangement that exposes the NLS in an extended conformation. Database Structural data are available in ... atoms) and r j is the standard deviation of B factors. The normalized B factors have a zero mean and unit variance. All atoms that satisfy B z ‡ 4 are treated as outliers and discarded. After...

Ngày tải lên: 14/02/2014, 19:20

14 744 0
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

... substrate-free AppA the C a atoms are 2.41 A ˚ apart, whereas for the substrate-free PhyK and the substrate-loaded AppA the averaged distance is only 1.87 A ˚ . Distinct conformational changes ... RHGXRXP and HD, and hydrolyze metal-free phytate with pH optima in the acidic range. They consist of two domains, a large a ⁄ b domain and a small a domain with the catalytic site...

Ngày tải lên: 16/02/2014, 09:20

13 767 0
Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx

Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx

... Nicholls A, Bharadwaj R & Honig B (1993) Grasp – graphical representation and analysis of surface-proper- ties. Biophys J 64, A1 66 A1 66. Crystal structure of the catalytic domain of DESC1 ... Shimomura T, Denda K, Kitamura A, Kawaguchi T, Kito M, Kondo J, Kagaya S, Qin L, Takata H, Miyazawa K et al. (1997) Hepatocyte growth factor activator inhibitor, a novel Kunitz-type...

Ngày tải lên: 19/02/2014, 00:20

13 588 0
Tài liệu Báo cáo khoa học: Crystal structure of the BcZBP, a zinc-binding protein from Bacillus cereus doc

Tài liệu Báo cáo khoa học: Crystal structure of the BcZBP, a zinc-binding protein from Bacillus cereus doc

... Ivanova N, Sorokin A, Anderson I, Galleron N, Candelon B, Kapatral V, Bhattacharyya A, Reznik G, Mikhailova N, Lapidus A et al. (2003) Genome sequence of Bacillus cereus and comparative analysis with ... systematically fell outside the allowed regions of a Ramachandran plot. Asp14 is the only BcZBP residue that adopts an energetically unfavorable main chain conformation through whic...

Ngày tải lên: 19/02/2014, 00:20

11 711 0
Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx

Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx

... temperatures, are a reduced number of noncovalent intra- and intermolecular interactions, less compact packing of the hydrophobic core, an increased apolar surface area, decreased metal ion affinity, ... Stability and structural analysis of alpha-amylase from the antarctic psychrophile Alteromonas haloplanctis A2 3. Eur J Biochem 222, 441– 447. 51 Almog O, Gonzalez A, Klein D, Gree...

Ngày tải lên: 19/02/2014, 16:20

14 597 0
Báo cáo khoa học: Crystal structure of a glycoside hydrolase family 6 enzyme, CcCel6C, a cellulase constitutively produced by Coprinopsis cinerea pot

Báo cáo khoa học: Crystal structure of a glycoside hydrolase family 6 enzyme, CcCel6C, a cellulase constitutively produced by Coprinopsis cinerea pot

... Kurakata 2 , Takatsugu Miyazaki 2 , Kiyohiko Igarashi 3 , Masahiro Samejima 3 , Kiyoharu Fukuda 1 , Atsushi Nishikawa 2 and Takashi Tonozuka 2 1 Department of Environmental and Natural Resource Science, ... HinCel 6A and CcCel6C (Fig. 2) indicated that Asp150 and Asp334 of CcCel6C are the potential catalytic residues and could act as a proton donor and a base, respectively. Another a...

Ngày tải lên: 15/03/2014, 10:20

11 489 0
Báo cáo khoa học: Crystal structure of RNase A tandem enzymes and their interaction with the cytosolic ribonuclease inhibitor potx

Báo cáo khoa học: Crystal structure of RNase A tandem enzymes and their interaction with the cytosolic ribonuclease inhibitor potx

... Schwalbach, Germany). Activity assay For analysis of the catalytic activity of SGRSGRSG-RATE in comparison with that of RNase A, a fluorometric assay employing the low molecular mass substrate FAM-AUAA-T AMRA ... RNases. Abbreviations BS-RNase, bovine seminal RNase; ds-RNase A, domain-swapped RNase A; FAM-AUAA-TAMRA, 6-carboxyfluorescein-dArU(dA) 2 -6- carboxytetramethylrhodamine;...

Ngày tải lên: 22/03/2014, 16:21

10 542 0
Báo cáo khoa học: Crystal structure of the halotolerant c-glutamyltranspeptidase from Bacillus subtilis in complex with glutamate reveals a unique architecture of the solvent-exposed catalytic pocket docx

Báo cáo khoa học: Crystal structure of the halotolerant c-glutamyltranspeptidase from Bacillus subtilis in complex with glutamate reveals a unique architecture of the solvent-exposed catalytic pocket docx

... was amplified by PCR from the plasmid pCY167 (Suzuki H & Yamada C, Unpublished), using forward primer 5¢- CATATGGATGAGTACAAACA AGTAGATG-3¢ and reverse primer 5¢- GGATCCTCGAG CTCATTTACGTTTTAAATTAATGCCGAT-3¢ ... La Jolla, CA, USA) with forward primer 5¢-GAAACGATGC ATTTGTCCTATGCCGACCGTGCGTC-3¢ and reverse primer 5¢-GACGCACGGTCGGCATAGGACAAATGCA TCGTTTC-3¢. The sequence of the second PCR prod...

Ngày tải lên: 22/03/2014, 21:20

10 375 0
Báo cáo khoa học: Crystal structure of a cold-adapted class C b-lactamase potx

Báo cáo khoa học: Crystal structure of a cold-adapted class C b-lactamase potx

... hydrolysis of the critical b-lactam ring and render the antibiotic inactive against its original cellular target, the cell wall transpeptidase. b-Lactamases of Keywords class C b-lactamase; cold adaptation; psychrophile; ... structure of the class C b-lactamase from E. cloacae P99 (Protein Data Bank code 2BLT) as a search model. The model was solved to a resolution of 2.2 A...

Ngày tải lên: 23/03/2014, 07:20

11 341 0
w