Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx

Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx

Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx

... organisms are capable of metabolizing methylglyoxal, via a methylglyoxal reductase-dependent pathway, to l-lactate; however, it remains to be seen whether this is the predominant pathway for methylglyoxal ... centrifugation Fig. 5. Metabolism of methylglyoxal. In T. cruzi and L. major, the principal end-prod- uct of methylglyoxal metabolism is D-lactate. In the absence...

Ngày tải lên: 23/03/2014, 06:20

11 646 0
Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx

Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx

... number of training samples. 3 Evaluations From the four tasks we consider, parsing and lan- guage model adaptation are both examples of re-ranking. In these tasks, we assume that we have been ... Newspaper). But in the linear model their feature weights were trained discriminatively on an adaptation domain corpus (Encarta Encyclopedia). Thus, this forms a cross domain adapta...

Ngày tải lên: 08/03/2014, 02:21

8 506 0
Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

... Proceedings of the 47th Annual Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 941–948, Suntec, Singapore, 2-7 August 2009. c 2009 ACL and AFNLP A Comparative Study of Hypothesis Alignment ... from Machine Translation Systems. In Proceeding of EMNLP. Hawaii, US, Oct. F. Huang and K. Papinent. 2007. Hierarchical System Combination for Machine Translation. In...

Ngày tải lên: 17/03/2014, 01:20

8 548 1
Báo cáo khoa học: "A Comparative Study of Reinforcement Learning Techniques on Dialogue Management" pdf

Báo cáo khoa học: "A Comparative Study of Reinforcement Learning Techniques on Dialogue Management" pdf

... ”Demokritos”, Institute of Informatics & Telecommunications and Univ. of Texas at Arlington, Comp. Science and Engineering alexandros.papangelis@mavs.uta.edu Abstract Adaptive Dialogue Systems are rapidly ... with P t (d j |d i , a m ) ∈ [1 − , 1], with varying  and available action density values. At each run, each algorithm was evaluated using the same transition probabilities a...

Ngày tải lên: 17/03/2014, 22:20

10 506 0
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

... ATATAT CATATGTCCGGTGTCGCAAAG R-TryX ATATA GGATCCTTACTCGTCTCTCCACGG F-TryP1 ATATAT CATATGTCCTGCGGTAACGCC R-TryP1 ATATA GGATCCTTACTGCTTGCTGAAGTATC F-TDPX1 Cys35Ala CAACGTAGCCAGCAAG GCCGGCTTCACCAAGGGCG R-TDPX1 Cys35Ala ... codons of the mutated amino acids are in bold. Cloned protein or mutation primer (5’- to 3’) F-TDPX1 TATAT CATATGTCTATCTACGACTTCAAGGTC R-TDPX1 ATATA GGATCCTCACGATTGAGTGCTT...

Ngày tải lên: 23/03/2014, 07:20

16 484 0
Báo cáo khoa học: "A Comparative Study of Target Dependency Structures for Statistical Machine Translation" ppt

Báo cáo khoa học: "A Comparative Study of Target Dependency Structures for Statistical Machine Translation" ppt

... Comparative Study of Target Dependency Structures for Statistical Machine Translation Xianchao Wu ∗ , Katsuhito Sudoh, Kevin Duh † , Hajime Tsukada, Masaaki Nagata NTT Communication Science Laboratories, ... Laboratories, NTT Corporation 2-4 Hikaridai Seika-cho, Soraku-gun Kyoto 619-0237 Japan wuxianchao@gmail.com,sudoh.katsuhito@lab.ntt.co.jp, kevinduh@is.naist.jp,{tsukada.hajime,nagat...

Ngày tải lên: 30/03/2014, 17:20

5 412 0
Báo cáo khoa học: "A Pilot Study of Opinion Summarization in Conversations" docx

Báo cáo khoa học: "A Pilot Study of Opinion Summarization in Conversations" docx

... Pilot Study of Opinion Summarization in Conversations Dong Wang Yang Liu The University of Texas at Dallas dongwang,yangl@hlt.utdallas.edu Abstract This paper presents a pilot study of opinion summarization ... like Maximal Marginal Relevance (MMR), Latent Semantic Anal- ysis (LSA), and supervised methods that cast the ex- traction problem as a binary classification task have b...

Ngày tải lên: 17/03/2014, 00:20

9 442 0
Báo cáo khoa học: "A Comparative Study on Reordering Constraints in Statistical Machine Translation" potx

Báo cáo khoa học: "A Comparative Study on Reordering Constraints in Statistical Machine Translation" potx

... This task contains the pro- ceedings of the Canadian parliament, which are kept by law in both French and English. About 3 million parallel sentences of this bilingual data have been made available ... Canadian Hansards task the coverage increases from about 87% to about 96%. We have presented a polynomial-time search al- gorithm for statistical machine translation based on the ITG co...

Ngày tải lên: 17/03/2014, 06:20

8 410 0
Báo cáo khoa học: "A Comparative Study on Generalization of Semantic Roles in FrameNet" ppt

Báo cáo khoa học: "A Comparative Study on Generalization of Semantic Roles in FrameNet" ppt

... seman- tic representations, SRL has attracted much at- tention from researchers into various NLP appli- cations including question answering (Narayanan and Harabagiu, 2004; Shen and Lapata, 2007; buy.v ... Proceedings of the 47th Annual Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 19–27, Suntec, Singapore, 2-7 August 2009. c 2009 ACL and AFNLP A Comparative Study on...

Ngày tải lên: 17/03/2014, 01:20

9 553 0
Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

... lymphocytes. Anthracyclines are among the most potent and clinically useful drugs in cancer treatment [1]. Anthracycline anti- biotics are DNA intercalators [2,3], and the antitumor activity of daunorubicin, a prominent ... A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 Silvia Villamarı ´ n 1, *, Sylvia Mansilla 1, *, Neus Ferrer...

Ngày tải lên: 20/02/2014, 23:20

7 583 0
w