Báo cáo khoa học: Unique ganglioside binding by botulinum neurotoxins C and D-SA pdf

Báo cáo khoa học: Unique ganglioside binding by botulinum neurotoxins C and D-SA pdf

Báo cáo khoa học: Unique ganglioside binding by botulinum neurotoxins C and D-SA pdf

... in contributing to the coordina- tion of ganglioside binding by HCR ⁄ C and HCR ⁄ D-SA. Thus, HCR ⁄ C and HCR ⁄ D-SA utilize the GBL for ganglioside binding. The GBLs of BoNT ⁄ C, BoNT ⁄ D and ... of HCR ⁄ C and HCR ⁄ D, but lacking a Trp. Ganglioside binding by HCR ⁄ C and HCR ⁄ D-SA Early studies showed that HCR ⁄ C bound GD1b and GT1b [46]. Quant...

Ngày tải lên: 22/03/2014, 15:21

11 363 0
Báo cáo khoa học: The enzyme-binding region of human GM2-activator protein pdf

Báo cáo khoa học: The enzyme-binding region of human GM2-activator protein pdf

... phosphatidic acid (20 mol%), 2-NBD–GM1 (2 mol%) and rhodamine–PE (2 mol%). Acceptor vesicles comprised PtdCho (60 mol%), Chol (20 mol%) and phosphatidic acid (20 mol%). The final donor vesicle concentration ... sequencing kit, both from Applied Biosystems (Foster City, CA). Recombinant bacu- loviruses were then generated by cotransfection of Sf9 cells with the respective transfer vector...

Ngày tải lên: 07/03/2014, 12:20

10 431 0
Báo cáo khoa học: "Deciphering Foreign Language by Combining Language Models and Context Vectors" pdf

Báo cáo khoa học: "Deciphering Foreign Language by Combining Language Models and Context Vectors" pdf

... of the active candidates and their respective probabili- ties are already correct, we induce new active candi- dates. In the context of information retrieval, Salton et al. (1975) introduce a document ... a new training procedure whose critical parts have constant time and memory complexity with respect to the vocab- ulary size so that our methods can scale to much larger vocabulary sizes...

Ngày tải lên: 16/03/2014, 19:20

9 356 0
Báo cáo khoa học: Regulation of matrix metalloproteinase activity in health and disease pdf

Báo cáo khoa học: Regulation of matrix metalloproteinase activity in health and disease pdf

... connective tissue growth factor (CCN2 ⁄ CTGF) promoter and activated transcription of CCN2 ⁄ CTGF. This growth factor promotes physio- logical chondrocytic proliferation and ECM formation. Pro- and ... the CSPG core protein will have altered biochemical prop- erties compared to unbound active MMP-9. Such properties may include substrate specificity, catalytic efficiency and ability to i...

Ngày tải lên: 15/03/2014, 00:20

18 464 0
Báo cáo khoa học: "Dialect MT: A Case Study between Cantonese and Mandarin" pdf

Báo cáo khoa học: "Dialect MT: A Case Study between Cantonese and Mandarin" pdf

... in China. In the following sections we will discuss inter-dialect MT with special emphasis on the pair of Chinese Cantonese and Chinese Mandarin. 1 Dialects and Chinese Dialects Dialects ... selected to represent both input and output sentences, because in China pinyins are the most popular tools to learn dialects and to input Chinese characters to computers. Chinese pinyin s...

Ngày tải lên: 23/03/2014, 19:20

5 441 0
Báo cáo khoa học: "Aflexible distributed architecture for NLP system development and use" pdf

Báo cáo khoa học: "Aflexible distributed architecture for NLP system development and use" pdf

... distributed architecture for NLP system development and use Freddy Y. Y. Choi Artificial Intelligence Group University of Manchester Manchester, U.K. choif@cs.man.ac.uk Abstract We describe a ... Engineering Architec- ture. architecture and techniques that are more gen- erally applicable, and it is these which we will focus on in this paper. 2 Architecture I System input...

Ngày tải lên: 23/03/2014, 19:20

4 273 0
Tài liệu Báo cáo khoa học: Is ATP binding responsible for initiating drug translocation by the multidrug transporter ABCG2? docx

Tài liệu Báo cáo khoa học: Is ATP binding responsible for initiating drug translocation by the multidrug transporter ABCG2? docx

... ABCB1, ABCC1 and ABCG2. Specifically, ABCG2 has been implicated in clinical multidrug resistance in acute myeloid leu- kaemia [5–8]. However, although ABCB1 and ABCC1 have been extensively characterized, ... thank TMW and DCS for critical assessment of all aspects of the project. References 1 Mellor HR & Callaghan R (2008) Resistance to chemo- therapy in cancer: a complex and integ...

Ngày tải lên: 18/02/2014, 18:20

9 566 0
Báo cáo khoa học: The natural mutation by deletion of Lys9 in the thrombin A-chain affects the pKa value of catalytic residues, the overall enzyme’s stability and conformational transitions linked to Na+ binding pdf

Báo cáo khoa học: The natural mutation by deletion of Lys9 in the thrombin A-chain affects the pKa value of catalytic residues, the overall enzyme’s stability and conformational transitions linked to Na+ binding pdf

... Palla 3 , Flora Peyvandi 3 , Cosimo Altomare 2 and Pier Mannuccio Mannucci 3 1 Haemostasis Research Centre, Institute of Internal Medicine and Geriatrics, Catholic University School of Medicine, Rome, ... within the A-chain and between the A- and B-chains occurs mainly through salt bridges and H bonds involving charged side chains. The A-chain is intramolecularly cross-linked by fi...

Ngày tải lên: 07/03/2014, 12:20

11 554 0
Báo cáo khoa học: pyr RNA binding to the Bacillus caldolyticus PyrR attenuation protein – characterization and regulation by uridine and guanosine nucleotides potx

Báo cáo khoa học: pyr RNA binding to the Bacillus caldolyticus PyrR attenuation protein – characterization and regulation by uridine and guanosine nucleotides potx

... caldolyti- cus, which we called BcBL1, BcBL2 and BcBL3, and the effects of nucleotides on RNA binding. A rapid and convenient filter binding assay [14] was used for many of these experiments. Electrophoretic ... lgÆmL )1 of acety- lated BSA, nucleotides at the indicated concentrations and various concentrations of native B. caldolyticus PyrR, which was purified as described previousl...

Ngày tải lên: 16/03/2014, 06:20

16 312 0
Báo cáo khoa học: Transcription factor specificity protein 1 (SP1) and activating protein 2a (AP-2a) regulate expression of human KCTD10 gene by binding to proximal region of promoter pot

Báo cáo khoa học: Transcription factor specificity protein 1 (SP1) and activating protein 2a (AP-2a) regulate expression of human KCTD10 gene by binding to proximal region of promoter pot

... TGTGGCTCTGTGGAACATTT Sp1FP GGACTACCTGGAGTGATGCCTAA Sp1RP CCCATCAACGGTCTGGAACT AP-2aFP CAACGTTACCCTGCTCACATCA Real-time PCR AP-2a RP CAGGTCGGTGAACTCTTTGCA b-actinFP GCGCGGCTACAGCTTCA b-actinRP CTTAATGTCACGCACGATTTCC Fig. ... CCAAGCTTCGGACTGAGAGAGGCAGGAA P()609 ⁄ +30)-F1 GGGGTACCTGGAGCACACACGCCAGATC P()343 ⁄ +30)-F2 GGGGTACCCGACGCACTACCGCCATCGT P()241 ⁄ +30)-F3 GGGGTACCCTTCTTCGCCCGGGAAGGAA P()2...

Ngày tải lên: 30/03/2014, 02:20

11 416 0
w