Báo cáo " Boundedness and Stability for a nonlinear difference equation with multiple delay " docx

Báo cáo " Oscilation and Convergence for a Neutral Difference Equation " pptx

Báo cáo " Oscilation and Convergence for a Neutral Difference Equation " pptx

... oscillations for neutral delay difference equation, J. Math. Anal. Appl. Vol. 166 (1992). [6] B. S. Lalli and B. G. Zhang, Oscillation and comparison theorems for certain neutral delay difference equation, ... differential equations of neutral type, J. Math. Anal. Appl, Vol. 18 (1967). [2] L. H. Huang and J. S. Ju, Asymptotic behavior of solutions for a class of diff...

Ngày tải lên: 14/03/2014, 13:20

11 405 0
Tài liệu Báo cáo " Fully parallel methods for a class of linear partial differential-algebraic equations " pptx

Tài liệu Báo cáo " Fully parallel methods for a class of linear partial differential-algebraic equations " pptx

... parallel methods for solving linear partial differential- algebraic equations (PDAEs) of the form: Au t + B∆u = f(x, t) (1) where A is a singular, symmetric and nonnegative matrix, while B is a ... Journal of Science, Mathematics - Physics 23 (2007) 201-209 Fully parallel methods for a class of linear partial differential-algebraic equations Vu Tien Dung ∗ Department of Mathemat...

Ngày tải lên: 13/02/2014, 03:20

9 628 0
Báo cáo " Calibration and verification of a hydrological model using event data " ppt

Báo cáo " Calibration and verification of a hydrological model using event data " ppt

... shown in table 2.2. Table 2.1. NAM parameter explanation and boundaries NAM Parameter NAM Parameter Description Unit Parameter boundaries U max Maximum water content in surface storage mm 10 ... event and therefore, the parameter space for the task of trial -and- error is narrowed. Verification: According to Refsgaard (1996), a model is said to be validated if its accuracy...

Ngày tải lên: 22/03/2014, 12:20

11 441 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

... casein. Samples and standards were applied in duplicate and incubated overnight at 4°C. Following the Vgf capture phase, the plates were reacted with rabbit anti-Vgf antibody (#9130 against Vgf 78-340 ) ... incubation with a reporter antibody (HRP–conjugated anti–rabbit IgG, Santa Cruz Biotech, CA). The assay was developed using a stabilized HRP substrate. All samples were a...

Ngày tải lên: 03/11/2012, 10:52

8 504 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC cyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG cyc1-z GCATCAGAAAGCATAGGC cyc1-m TGGGAATACGATAGAGTAG nb2 primer GTTTAAACGAGCTCGAATTC Coq7 in fission yeast R. ... GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG Spcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG Spcoq3-z GTATGCGATGTGGAATTTG Spcoq3-m GATGCCTTCCAATGAATTAC cyc1-w GAACCAATGAAATAAGGGCG cyc1-x...

Ngày tải lên: 18/02/2014, 14:20

16 647 0
Tài liệu Báo cáo khoa học: "Pseudo-Projectivity: A Polynomially Parsable Non-Projective Dependency Grammar" docx

Tài liệu Báo cáo khoa học: "Pseudo-Projectivity: A Polynomially Parsable Non-Projective Dependency Grammar" docx

... Pseudo-Projectivity: A Polynomially Parsable Non-Projective Dependency Grammar Sylvain Kahane* and Alexis Nasr t and Owen Rambowt • TALANA Universit@ Paris 7 (sk0ccr. jussieu.fr) t LIA Universit@ d'Avignon ... Vtrans ==~ yesterday Fernando thought Nnom eats Nob j A dv yesterday Fernando thought Carlos eats beans slowly Vclause Adv Nnom thought Vtrans yesterday Fernan...

Ngày tải lên: 20/02/2014, 18:20

7 351 0
Báo cáo khoa học: "Tools for Multilingual Grammar-Based Translation on the Web" docx

Báo cáo khoa học: "Tools for Multilingual Grammar-Based Translation on the Web" docx

... translation tools are based on GF, Grammati- cal Framework 4 (Ranta 2004). GF is a grammar formalism—that is, a mathematical model of natural language, equipped with a formal notation for writ- ing ... Gram- mar Library. smaller scale as regards languages and application do- mains. A running demo system is available at http: //grammaticalframework.org:41296 . 2 Multilingual Gram...

Ngày tải lên: 17/03/2014, 00:20

6 555 0
Báo cáo khoa học: NARG2 encodes a novel nuclear protein with (S/T)PXX motifs that is expressed during development docx

Báo cáo khoa học: NARG2 encodes a novel nuclear protein with (S/T)PXX motifs that is expressed during development docx

... gagt … ccac ag GGATGT 1.4 3 105 a TAACAG gt aata … ttcc ag ACGTAT 6.5 4 250 TATCTG gt atgt … taac ag GATATG 0.89 5 120 ACGGAG gt aaaa … tccc ag CAACTC 1.7 6 138 GTTTTG gt aaga … attt ag GGCAGT 0.52 7 117 ... 7.7 4 262 a TACTTG gt atgt … aatc ag GATATG 1.3 5 120 a ACAGAG gt aaaa … tctc ag AAAATT 9.9 6 138 GCATTG gt aagg … attt ag GGCAGT 1.2 7 117 CATTAT gt aagt … tttc ag GATATT 0.17 8 16...

Ngày tải lên: 23/03/2014, 13:20

9 471 0
w