14 point web copy analysis of a winning site pptx

14 point web copy analysis of a winning site pptx

14 point web copy analysis of a winning site pptx

... ((Audio Ebook)) Sponsor: Web Copy Secrets “Want Even More In-Depth Web Copywriting Analysis and to Learn How to Write Web Copy That Sells? This is Your Answer! 'Peel Away' Outrageously ... You can see I use a ‘prehead’ (this is the small headline above the main headline), a headline and a subhead. All 3 of these are powerful enough to be the main headlin...

Ngày tải lên: 19/03/2014, 20:20

24 419 0
Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal

Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal

... Climate Database and Retscreen Product Database. The economic and financial evaluation of the wind farm is made by the software RETScreen® International Clean Energy Project Analysis and the ... simulation and sensitivity analysis are summarized in Tables 12, 13, 14 and 15, in absolute and percentage values of case study scenarios analyzed. Table 13. Comparison of percentage...

Ngày tải lên: 05/09/2013, 14:59

14 417 1
Computational fluid dynamics analysis of a twisted airfoil shaped two-bladed H-Darrieus rotor made from fibreglass reinforced plastic (FRP)

Computational fluid dynamics analysis of a twisted airfoil shaped two-bladed H-Darrieus rotor made from fibreglass reinforced plastic (FRP)

... reinforced plastic (FRP) Rajat Gupta, Sukanta Roy, Agnimitra Biswas Department of Mechanical Engineering, National Institute of Technology, Silchar, Assam, 788010 India. Abstract H-Darrieus ... 0.265 at a TSR of 2. 214, and the maximum C t obtained is 0.124 at a TSR of 1.962. And the standard deviation of computational C p from experimental C p is 0.81% and t...

Ngày tải lên: 05/09/2013, 15:28

16 366 0
Reliability analysis of a power system based on the multi state system theory

Reliability analysis of a power system based on the multi state system theory

... is above 22.8 Ah, the system is reliable, though the capacity of a battery is lower than 5700 mAh. Suppose the capacity of the first branch is 5600 mAh and the capacity of other branches are ... b inary, but they are all multi-state actually. The performance of the batteries can degrade, which results in performance degradation of the power system. So there can be several sta...

Ngày tải lên: 03/01/2014, 19:38

4 409 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

... (p26-1Bam-s) GCGCGGATCCACCATGGCACTTAACCCATG 546/182 (P26-182 Xho-as) CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT p26-alpha 1–60 and (p26-60Bam-s) GCGCGGATCCACCATGTCCTTGAGGGACACA 297/93 153–192 (p26-153Xho-as) ... protein from Artemia franciscana Oligomerization and thermotolerance Julie A. Crack, Marc Mansour, Yu Sun and Thomas H. MacRae Department of Biology, Dalhousie University, Halifax, Nova Scot...

Ngày tải lên: 22/02/2014, 04:20

10 498 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

... Uppsala, Sweden Fax: +46 18 536971 Tel: +46 18 4 7141 77 E-mail: maria.selmer@icm.uu.se Database The atomic coordinates and observed structure factors are available in the Protein Data Bank database ... fusidic acid Yang Chen, Ravi Kiran Koripella, Suparna Sanyal and Maria Selmer Department of Cell and Molecular Biology, Uppsala University, Sweden Introduction Protein synthesis, translation...

Ngày tải lên: 06/03/2014, 22:21

15 476 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

... nm bandpass fil- ter). Data were recorded and analyzed with flowmax soft- ware from Partec. Statistical analysis of ELISA experiments Each experiment was repeated at least twice, with duplicate or ... in a microplate reader. SPR analysis SPR analysis of NTD binding to repeats was performed with the BIAcore X100 system (GE Healthcare). Goat anti- body against GST (30 lgÆmL )1 ; GE H...

Ngày tải lên: 06/03/2014, 22:21

16 569 0
Báo cáo khoa học: In situ proton NMR analysis of a-alkynoate biotransformations ppt

Báo cáo khoa học: In situ proton NMR analysis of a-alkynoate biotransformations ppt

... was decarboxylated to carbon dioxide and pyruvate. About 90% of the latter metabolite was than further hydrolysed to acetate and formate. Approximately 10% of the pyruvate was reduced to lactate, ... measurement parameters were adjusted: presaturation duration, 1.0 s; 1 H pulse angle, 90°; acquisition time, 2.0 s; relaxation delay, 1.5 s. A total of 128 scans was accumulated and after...

Ngày tải lên: 08/03/2014, 08:20

6 360 0
Security Analysis of a Cryptographically-Enabled RFID Device ppt

Security Analysis of a Cryptographically-Enabled RFID Device ppt

... standpoint of an attacker, active scanning has the advantage of permitting a chosen-challenge at- tack. Hence this type of attack permits the use of pre- computed Hellman tables as touched on above. ... that is, scanning it at short range for a frac- tion of a second. With additional use of an FPGA, an attacker can feasibly simulate a target DST after merely intercepting m...

Ngày tải lên: 16/03/2014, 19:20

15 550 0
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx

Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx

... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GT- cDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp). Construction and ... 5¢-TGTC AGTCCTGTACAAAGAC-3¢ and Primer B, 5¢-CAT CAGGCTTCCCCATA-3¢. Gene-specific nested primers for 3¢-RACE were: Primer C, 5¢-CCAGTGTCCCCAT CATCAG-3¢ and Primer D, 5¢-GGCAATTT...

Ngày tải lên: 17/03/2014, 03:20

8 466 0
w