Báo cáo khoa học: "Adaptivity in Question Answering with User Modelling and a Dialogue Interface" pptx

Báo cáo khoa học: "Adaptivity in Question Answering with User Modelling and a Dialogue Interface" pptx

Báo cáo khoa học: "Adaptivity in Question Answering with User Modelling and a Dialogue Interface" pptx

... controversial answers. We introduce adaptivity in QA and IR by cre- ating a hybrid system based on a dialogue interface and a user model. Keywords: question answering, information retrieval, user modelling, ... Adaptivity in Question Answering with User Modelling and a Dialogue Interface Silvia Quarteroni and Suresh Manandhar Department of Computer Sc...

Ngày tải lên: 17/03/2014, 22:20

4 294 0
Tài liệu Báo cáo khoa học: "The QuALiM Question Answering Demo: Supplementing Answers with Paragraphs drawn from Wikipedia" ppt

Tài liệu Báo cáo khoa học: "The QuALiM Question Answering Demo: Supplementing Answers with Paragraphs drawn from Wikipedia" ppt

... shown, and in this paragraph one sentence containing the answer is highlighted. Note also, that each paragraph contains a link that takes the user to the Wikipedia article, should he/she want to ... reasons: 1. QuALiM is an open domain Question Answer- ing system and Wikipedia is an “open domain” Encyclopedia; it aims to cover all areas of inter- est as long as they are of some ge...

Ngày tải lên: 20/02/2014, 09:20

4 478 0
Tài liệu Báo cáo khoa học: "ISSUES IN NATURAL LANGUAGE ACCESS TO DATABASES FROM A LOGIC PROGRAMMING PERSPECTIVE" doc

Tài liệu Báo cáo khoa học: "ISSUES IN NATURAL LANGUAGE ACCESS TO DATABASES FROM A LOGIC PROGRAMMING PERSPECTIVE" doc

... the Scandinavian countries linked by rail?". In cases involving aggregate operators such as "total" and "average", an indexed set is clearly needed, and Chat handles ... general programs as well as to databases. Current Prolog systems, because they were designed with programming not databases in mind, are not capable of accommodating really large da...

Ngày tải lên: 21/02/2014, 20:20

4 446 0
Báo cáo khoa học: Changes in specific lipids regulate BAX-induced mitochondrial permeability transition pptx

Báo cáo khoa học: Changes in specific lipids regulate BAX-induced mitochondrial permeability transition pptx

... and western blotting. The horizontal line indicates the samples with added rBAX. Membranes were incubated against anti-BAX mAb, stripped, and evaluated for VDAC content to check protein loading. ... to alkaline extraction before SDS ⁄ PAGE fractioning and western blotting. Membranes were incubated against anti-BAX mAb, stripped, and evaluated for VDAC content to check loading. Blots...

Ngày tải lên: 07/03/2014, 05:20

11 449 0
Báo cáo khoa học: Changes in microRNAs associated with hepatic stellate cell activation status identify signaling pathways docx

Báo cáo khoa học: Changes in microRNAs associated with hepatic stellate cell activation status identify signaling pathways docx

... (Pierce), and antibody against actin (Santa Cruz, CA, USA) (1 : 500) as an internal standard. Statistical analysis All of the results are expressed as mean ±standard devia- tion. Statistical analysis ... comparative bioinformatics analysis of micro- arrays of quiescent and activated HSCs. Changes in miRNAs associated with HSC activation status revealed that 13 pathways were upregulate...

Ngày tải lên: 30/03/2014, 01:20

14 481 0
Báo cáo khoa học: Biotinylation in the hyperthermophile Aquifex aeolicus Isolation of a cross-linked BPL:BCCP complex pptx

Báo cáo khoa học: Biotinylation in the hyperthermophile Aquifex aeolicus Isolation of a cross-linked BPL:BCCP complex pptx

... 5¢-TTCTTAA CCATGG GCTTCAAAAACCTGAT-CTGG-3¢;BPL-rev,5¢-TTAA GGATCCTAAGAACGAGACAGGCTGAACTCTCC-3¢; BCCPD67, 5¢-GTAA CCATGGGTGAACAGGAAGA A- 3¢;BCCP-rev,5¢- GGATCCTTAAACGTTTGTGTC TATAAG-3¢; BCCP K117L, 5¢-GAAGCTCTACTG GTTATGAAC-3¢. DNA was isolated from agarose using a ... details are as follows (restriction sites are indicated by underlining and mutagenic changes are shown in bold). BPL-fo...

Ngày tải lên: 31/03/2014, 07:20

11 581 0
Tài liệu Báo cáo khoa học: Functional interaction between RNA helicase II⁄Gua and ribosomal protein L4 pptx

Tài liệu Báo cáo khoa học: Functional interaction between RNA helicase II⁄Gua and ribosomal protein L4 pptx

... antisense YH9 ATGGCCTCAGTTCCGAAAACCAACAAAATAGA Northern blot analysis probe, for 18S rRNA YH11 TTCTGACTTAGAGGCGTTCAGTCATAATCCCA Northern blot analysis probe, for 28S rRNA H. Yang et al. Gua–RPL4 interaction ... human Gua and FLAG-tagged human RPL4 deletion mutant shown in (D) were immunoprecipitated using anti-FLAG resin and blotted as indicated. H. Yang et al. Gua–RPL4 interaction in...

Ngày tải lên: 20/02/2014, 01:20

15 434 0
Tài liệu Báo cáo khoa học: "Japanese Dependency Parsing Using Co-occurrence Information and a Combination of Case Elements" pdf

Tài liệu Báo cáo khoa học: "Japanese Dependency Parsing Using Co-occurrence Information and a Combination of Case Elements" pdf

... data (different from the training data) 1 . Reranking Candidate 1 Candidate 2 Candidate 3 Candidate 4 : Case element : Verb Candidate Candidate Figure 2: Selection of possible parses for reranking Many ... using a Japanese depen- dency analyzer such as KNP (Kurohashi and Na- gao, 1994) or CaboCha (Kudo and Matsumoto, 2002). Although this information is less accu- rate than manually anno...

Ngày tải lên: 20/02/2014, 12:20

8 484 0
Báo cáo khoa học: "Shallow parsing on the basis of words only: A case study" pptx

Báo cáo khoa học: "Shallow parsing on the basis of words only: A case study" pptx

... inductive learning algorithm for learning classification tasks. Memory-based learning treats a set of labeled (pre-classified) training instances as points in a multi-dimensional feature space, and stores ... types of input. Second, there are indications that increasing the training set of language processing tasks produces much larger performance gains than varying among algorithms at...

Ngày tải lên: 08/03/2014, 07:20

8 659 0
Báo cáo khoa học: "Natural Language Generation as Planning Under Uncertainty for Spoken Dialogue Systems" pptx

Báo cáo khoa học: "Natural Language Generation as Planning Under Uncertainty for Spoken Dialogue Systems" pptx

... supervised learning of dialogue policies from fixed datasets. Computational Linguistics (to appear). Srinivasan Janarthanam and Oliver Lemon. 2008. User simulations for online adaptation and knowledge- alignment ... knowledge- alignment in Troubleshooting dialogue systems. In Proc. of SEMdial. Alexander Koller and Ronald Petrick. 2008. Experi- ences with planning for natural...

Ngày tải lên: 08/03/2014, 21:20

9 301 0
w