Báo cáo khoa học: "WISDOM: A Web Information Credibility Analysis System" potx

Tài liệu Báo cáo khoa học: "WebCAGe – A Web-Harvested Corpus Annotated with GermaNet Senses" docx

Tài liệu Báo cáo khoa học: "WebCAGe – A Web-Harvested Corpus Annotated with GermaNet Senses" docx

... perfor- mance of WSD algorithms for languages such as English for which hand-crafted sense-annotated corpora have been available (Agirre et al., 2007; Erk and Strapparava, 2012; Mihalcea et al., ... amount of data that can reasonably be annotated by hand. Leacock et al. (1998), Agirre and Lopez de La- calle (2004), and Mihalcea and Moldovan (1999) propose a set of methods for automatic harv...

Ngày tải lên: 22/02/2014, 03:20

10 419 0
Báo cáo khoa học: TICL – a web tool for network-based interpretation of compound lists inferred by high-throughput metabolomics doc

Báo cáo khoa học: TICL – a web tool for network-based interpretation of compound lists inferred by high-throughput metabolomics doc

... Yamada T, Kanehisa M & Bork P (2008) iPath: interactive exploration of biochemical pathways and networks. Trends Biochem Sci 33, 101–103. 33 Okuda S, Yamada T, Hamajima M, Itoh M, Katayama T, ... database information currently available for metabolic and signaling pathways, such as the Kyoto Encyclopedia of Genes and Genomes (KEGG) [23] or BioCarta (http://www.biocarta.com). In this cas...

Ngày tải lên: 16/03/2014, 01:20

11 402 0
Báo cáo khoa học: "PENS: A Machine-aided English Writing System for Chinese Users" pdf

Báo cáo khoa học: "PENS: A Machine-aided English Writing System for Chinese Users" pdf

... propose an approach to machine aided English writing system, which consists of two components: 1) a statistical approach to word spelling help, and 2) an information retrieval based approach to intelligent ... They basically fall into two categories, 1) automatic translation, and 2) translation memory. Both work at the sentence level. While in the former, the translation is not readable e...

Ngày tải lên: 08/03/2014, 05:20

8 396 0
Báo cáo khoa học: "Towards a Semantic Classification of Spanish Verbs Based on Subcategorisation Information" doc

Báo cáo khoa học: "Towards a Semantic Classification of Spanish Verbs Based on Subcategorisation Information" doc

... best classification tasks in terms of the Silhou- ette measure are the 3-way and 15-way classifica- tions. The baseline is calculated, for each task, as the average value of the Adjusted Rand measure ... attachment or grammatical function of the constituents, we have to take into account that the extraction is an approximation. There are various phenomena that can lead us to an erroneous extrac...

Ngày tải lên: 08/03/2014, 04:22

6 420 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor. ... Yokohama, Japan 2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, Japan Introduction Type II transmembrane serine proteases (...

Ngày tải lên: 15/02/2014, 01:20

13 643 0
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

... from bacterial genomics. Nat Prod Rep 24, 1073–1109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of angiotensin-converting enzyme, ... (Hartmann Analytic, Braunschweig, Germany) was added. The supernatants were extracted with XAD16 resin after an additional 2 days of growth. The dried eluate was dissolved...

Ngày tải lên: 16/02/2014, 09:20

14 619 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses Kristiina A. Vuori 1 , Johanna K. Ahlskog 2 , Lea Sistonen 2 and Mi...

Ngày tải lên: 18/02/2014, 14:20

9 458 0
Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

... Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H, Hamasaki K et al. (2003) Interferon -a sensitizes human hepatoma cells to TRAIL-induced apoptosis ... 40760–40767. 34 Yamada H, Tada-Oikawa S, Uchida A & Kawanishi S (1999) TRAIL causes cleavage of bid by caspase-8 and loss of mitochondrial membrane potential resulting in apoptosis in BJAB...

Ngày tải lên: 19/02/2014, 06:20

11 680 0
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG TTCCCTGTCCAGTGTTACC-3¢. ... African trypanosome Trypanosoma brucei is the protozoon that causes the fatal human sleeping sickness, as well as Nagana, a devastating...

Ngày tải lên: 19/02/2014, 12:20

11 568 0
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

... were analyzed and quantified on a Fuji Bio-Imaging analyzer BAS-2500 using IMAGE GAUGE V3.3 software. Chromatin and protein–DNA analysis Micrococcal nuclease (MNase) digestion and in situ cleavage by ... Biotechnology) and acetylated H3 (Upstate Bio- technology), and antibodies against specific modifications such as acetylated H3-K9 (Cell Signaling Technology) and H3-K14 (Abcam) and anti-H3...

Ngày tải lên: 19/02/2014, 12:20

10 506 0
Từ khóa:
w