... provide an apt summary of the situation. Their 'test for relational phrases' is a good start, but geared towards the English language (we are investigat- ing German as well), and furthermore ... though. As we have illustrated above and will elaborate below, these words can carry a wide variety of semantic and pragmatic overtones, which render the choice of a marker mea...
Ngày tải lên: 20/02/2014, 18:20
... hotondo-no gakusei-ga hanasu every language-ace most-gen student-nora speak d. Subete-no gengo-wa hotondo-no gakusei-ga hanasu every language-TOP most-gen student-nora speak Several proposals ... Parameters are used in SEL to trans- late anaphoric expressions of English. A parameter behaves semantically as an open variable, a value for which has to be provided by context. 7 I...
Ngày tải lên: 20/02/2014, 21:20
Tài liệu Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" docx
... corpora are available, also the translation equivalents of the collocation context are displayed, thus allowing the user to see how a given collocation was translated in different lan- guages, and ... length-based and integrates a shal- low content analysis. It begins by individuating a paragraph in the target text which is a first candi- date as target paragraph, and which we call...
Ngày tải lên: 22/02/2014, 02:20
Báo cáo khoa học: "Transonics: A Practical Speech-to-Speech Translator for English-Farsi Medical Dialogues" docx
... (Srini- vasamurthy & Narayanan 2003), as well as use of a small existing Farsi speech corpus (FARSDAT), and our own team-internally generated acoustic data. Language modeling data was also obtained from ... both a Classifier and a stochastic translation engine, both 1 Standardized Patients are typically actors who have been trained by doctors or nurses to portray symptoms of pa...
Ngày tải lên: 08/03/2014, 04:22
Báo cáo khoa học: "Automatic Compensation for Parser Figure-of-Merit Flaws*" pot
... ing at a tag stream, ignoring lexical infor- mation.) Given a few basic independence as- sumptions (Caraballo and Charniak, 1998), this value can be calculated as i i fl( N ,k) P(NJ'k]t°'~) ... possibility is that the statistical method runs into too many sparse data problems around the fringe of the data set were we able to use a larger data set, we might see the...
Ngày tải lên: 08/03/2014, 06:20
Báo cáo khoa học: "FOR A N EFFICIENT CONTEXT-FREE PARSER AUGMENTED PHRASE-STRUCTURE GRAMMARS" potx
... grammars, the augmented phrase-structure grammars (APSGs), and the semantic grammars. All of them have different characteristics and different advantages. In particular APSGs offer a natural ... recently, also on a SUN workstation, as the main component of a transportable Natural Language Interface (SAIL = Sistema per I'Analisi e I'lnterpretazione del Linguaggio)....
Ngày tải lên: 09/03/2014, 01:20
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf
... H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor. ... factor activator inhibitor type 1; HAI-2, hepatocyte growth factor activator inhibitor type 2; HGF, hepatocyte growth factor; HGFA, hepatocyte growth factor activator; HPAI, highly pathogenic avian ....
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx
... (Hartmann Analytic, Braunschweig, Germany) was added. The supernatants were extracted with XAD16 resin after an additional 2 days of growth. The dried eluate was dissolved in 10% methanol and analyzed ... nonribosomal peptide synthetases: the emerging view from bacterial genomics. Nat Prod Rep 24, 1073–1109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuc...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses Kristiina A. Vuori 1 , Johanna K. Ahlskog 2 , Lea Sistonen 2 and Mi...
Ngày tải lên: 18/02/2014, 14:20