Báo cáo khoa học: "Augmented Dependency Grammer: A Simple Interface between the Grammer Rule and the Knowledge" pptx

Báo cáo khoa học: "Augmented Dependency Grammer: A Simple Interface between the Grammer Rule and the Knowledge" pptx

Báo cáo khoa học: "Augmented Dependency Grammer: A Simple Interface between the Grammer Rule and the Knowledge" pptx

... It also explains the gap in semantics and logical meaning, and gives a clear computaional image of what we call conceptual analysis. This grammar is used for analysis of Japanese and synthesis ... binary case relations, fits the dependency grammar very well, since both dependency and case relation are basically binary. The dependency analysis also correlates to t...

Ngày tải lên: 09/03/2014, 01:20

7 376 0
Tài liệu Báo cáo khoa học: "Topological Dependency Trees: A Constraint-Based Account of Linear Precedence" ppt

Tài liệu Báo cáo khoa học: "Topological Dependency Trees: A Constraint-Based Account of Linear Precedence" ppt

... an ‘oblig- atory auxiliary flip’. (18) (dass) (that) Maria Maria einen a Mann man hat has lieben love k ¨ onnen can (that) Maria was able to love a man (19) (dass) Maria hat einen Mann lieben ... behavior is called ‘optional auxiliary flip’. (11) (dass) (that) Maria Maria einen a Mann man lieben love k ¨ onnen can wird will (that) Maria will be able to love a man (12) (dass) Maria einen...

Ngày tải lên: 20/02/2014, 18:20

8 354 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI Y74W* WT* W11F ... complementary mutations Mousumi Banerjee 1 , Hemalatha Balaram 2 and Padmanabhan Balaram 1 1 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India 2 Molecular Biology and G...

Ngày tải lên: 18/02/2014, 11:20

15 635 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... h and then cut with ClaI (C and D). DNA was separated by electrophoresis on an agarose gel and the ethidium bromide fluorescence recorded to quantify DNA (A and C). The DNA was then electrotransferred ... recorded (A and C). The DNA was then transferred to a nylon membrane and TPP moieties covalently attached to the DNA were visualized using anti-TPP serum (B and D)....

Ngày tải lên: 20/02/2014, 11:20

10 640 0
Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf

Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf

... calcium ions in the activation and activ- ity of the transglutaminase 3 enzyme. J Biol Chem 278, 23834–23841. 30 Hitomi K, Presland RB, Nakayama T, Fleckman P, Dale BA & Maki M (2003) Analysis ... which all the glutamine residues were substituted by asparagine residues, and fused with a peptide at the N-terminus and hexahistidine at the C-terminus [15]. The DNA of each...

Ngày tải lên: 29/03/2014, 21:20

11 645 0
Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx

Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx

... form an internal nucleoskeleton as well as a peripheral lamina in human cells. J Cell Sci 108, 635–644. 10 Jagatheesan G, Thanumalayan S, Muralikrishna B, Rangaraj N, Karande AA & Parnaik ... pro- tein that associates with nuclear matrix. DNA Cell Biol 17, 849–858. 24 Lee JY, Nakane Y, Koshikawa N, Nakayama K, Hayashi M & Takenaga K (2000) Characterization of a zinc finger protein...

Ngày tải lên: 30/03/2014, 20:20

12 401 0
Báo cáo khoa học: Recent insights into cerebral cavernous malformations: animal models of CCM and the human phenotype pptx

Báo cáo khoa học: Recent insights into cerebral cavernous malformations: animal models of CCM and the human phenotype pptx

... the AB Fig. 3. Narrowed arteries associated with circulation failure in mice lacking Ccm2. The connections of the heart to the aorta, and the associated cranial portions of the dorsal aorta are ... in the vascular malformation. Between observational and genetic studies in humans and biochemical and cellular studies at the bench lies a gap. This minireview explores...

Ngày tải lên: 15/03/2014, 10:20

8 420 0
Báo cáo khoa học: Disease-related mutations in cytochrome c oxidase studied in yeast and bacterial models pptx

Báo cáo khoa học: Disease-related mutations in cytochrome c oxidase studied in yeast and bacterial models pptx

... activity of the enzyme but they might alter its assembly. L196I, G78S and DF94–F98 are located at the interface between subunits 1 and 3 and might weaken the assembly of these two subunits. A2 00T ... stationary phase. Based on densitometry meas- urements (see Materials and methods) G78S and A2 00T contain as much subunit 3 as the wild-type oxidase and DF94–F98 in la...

Ngày tải lên: 23/03/2014, 21:20

9 318 0
Tài liệu Báo cáo khoa học: "Japanese Dependency Parsing Using Co-occurrence Information and a Combination of Case Elements" pdf

Tài liệu Báo cáo khoa học: "Japanese Dependency Parsing Using Co-occurrence Information and a Combination of Case Elements" pdf

... data (different from the training data) 1 . Reranking Candidate 1 Candidate 2 Candidate 3 Candidate 4 : Case element : Verb Candidate Candidate Figure 2: Selection of possible parses for reranking Many ... obtained by using a Japanese depen- dency analyzer such as KNP (Kurohashi and Na- gao, 1994) or CaboCha (Kudo and Matsumoto, 2002). Although this information is less accu- rate than...

Ngày tải lên: 20/02/2014, 12:20

8 484 0
Báo cáo khoa học: "ENGLISH GENERATOR FOR A CASE-LABELLED DEPENDENCY REPRESENING" pdf

Báo cáo khoa học: "ENGLISH GENERATOR FOR A CASE-LABELLED DEPENDENCY REPRESENING" pdf

... notably as a part of a free text retrieval system and as part of a natural language front end to a relational database system. i. Introduction This pa[~er describes a progrmn which has been ... from the phrasal ~,~ clausal patterns. These rules contain most of the syst~n's knowleuge about the relatzonship between the constructs of Boguraev' s representat...

Ngày tải lên: 09/03/2014, 01:20

4 420 0
w