Báo cáo khoa học: "Acquiring a Lexicon from Unsegmented Speech" potx

Báo cáo khoa học: "Acquiring a Lexicon from Unsegmented Speech" potx

Báo cáo khoa học: "Acquiring a Lexicon from Unsegmented Speech" potx

... Acquiring a Lexicon from Unsegmented Speech Carl de Marcken MIT Artificial Intelligence Laboratory 545 Technology Square, NE43-804 Cambridge, MA, 02139, USA cgdemarc@ai.mit.edu Abstract ... pressure, and assume that learning takes place in an environment where simple semantic representations of the speech intent are available to the acquisition mechanism. For example, we app...

Ngày tải lên: 08/03/2014, 07:20

3 316 0
Báo cáo khoa học: "Building Emotion Lexicon from Weblog Corpora" potx

Báo cáo khoa học: "Building Emotion Lexicon from Weblog Corpora" potx

... cy- bermedia in our internet lives that captures and shares moments of our day-to-day experiences, anytime and anywhere. Blogs are web sites that timestamp posts from an individual or a group ... col- lected. Each blogger posts 16 articles on average. We used the articles from January to June as the training set and the articles in July as the testing set. Table 2 shows the statis...

Ngày tải lên: 17/03/2014, 04:20

4 303 0
Tài liệu Báo cáo khoa học: "Acquiring Lexical Generalizations from Corpora: A Case Study for Diathesis Alternations" pdf

Tài liệu Báo cáo khoa học: "Acquiring Lexical Generalizations from Corpora: A Case Study for Diathesis Alternations" pdf

... which diathesis alternations are empirically attested in corpus data. Using the dative and bene- factive alternations as a test case we attempt to de- termine: (a) if some alternations are more ... acquire alternating verbs from large balanced corpora by using partial- parsing methods and taxonomic information, and discuss how corpus data can be used to quantify lin- guistic genera...

Ngày tải lên: 20/02/2014, 19:20

8 485 0
Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx

Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx

... that the proper place for describing discourse markers is a dedicated lexicon that provides a classification of their syntactic, semantic and pragmatic features and characterizes the relationships ... markers, we do not regard this distinction as particularly helpful, though. As we have illustrated above and will elaborate below, these words can carry a wide variety of semantic...

Ngày tải lên: 20/02/2014, 18:20

5 535 0
Báo cáo khoa học: Novel a-conotoxins from Conus spurius and the a-conotoxin EI share high-affinity potentiation and low-affinity inhibition of nicotinic acetylcholine receptors doc

Báo cáo khoa học: Novel a-conotoxins from Conus spurius and the a-conotoxin EI share high-affinity potentiation and low-affinity inhibition of nicotinic acetylcholine receptors doc

... a 3 b 2 AnIB GGCCSHPACAANNQDYC a a 3 b 2 >> a 7 PnIA GCCSLPPCAANNPDYC a a 3 b 2 >> a 7 PnIB GCCSLPPCALSNPDYC a a 7 > a 3 b 2 EpI GCCSDPRCNMNNPDYC a a 3 b 4 , a 3 b 2 ; a 7 AuIA ... JM, ePlazas PV, Watkins M, Gomez-Casati ME, Olivera BM & Elgoyhen AB (2005) A novel alpha- conotoxin, PeIA, cloned from Conus pergrandis, discriminates between rat alpha9a...

Ngày tải lên: 16/03/2014, 11:20

14 533 0
Báo cáo khoa học: AtCYS1, a cystatin from Arabidopsis thaliana, suppresses hypersensitive cell death ppt

Báo cáo khoa học: AtCYS1, a cystatin from Arabidopsis thaliana, suppresses hypersensitive cell death ppt

... (forward: GGATCCGCGGATCAACAAG CAGGAACA) and a SalI site (reverse: GTCGACTCA CGTGGTCTGAGAGCACAC) for directional cloning (restriction sites underlined). The amplified fragment was subcloned into ... stable. After transformation, the majority of agrobacteria were removed by extensive washing and the A. thaliana cells were in part analysed for transgene activity (Fig. 3A) and in part challenge...

Ngày tải lên: 17/03/2014, 03:20

12 240 0
Báo cáo khoa học: Ixocarpalactone A isolated from the Mexican tomatillo shows potent antiproliferative and apoptotic activity in colon cancer cells pot

Báo cáo khoa học: Ixocarpalactone A isolated from the Mexican tomatillo shows potent antiproliferative and apoptotic activity in colon cancer cells pot

... 20 Caceres A, Alvarez AV, Ovando AE & Samayoa BE (1991) Plants used in Guatemala for the treatment of respiratory diseases. 1. Screening of 68 plants against gram-positive bacteria. J Ethnopharmacol ... known as a tomatillo, is a staple of the Mesoamerican cuisine. In our laboratory, an ethyl acetate-soluble extract and four withanolides [ixocarpalactone A (IxoA), ixocarpalac- tone...

Ngày tải lên: 23/03/2014, 10:20

10 310 0
Báo cáo khoa học: "Extracting a Representation from Text for Semantic Analysis" doc

Báo cáo khoa học: "Extracting a Representation from Text for Semantic Analysis" doc

... facet. Finally, we train a machine learning classi- fier on training data and use it to classify unseen test examples, assigning a Table 1 label for each reference answer facet. We used a variety ... answer facets that are not ad- dressed at all by the student’s answer Table 1. Facet Annotation Labels 3 Automated Classification As partial validation of this knowledge representa-...

Ngày tải lên: 23/03/2014, 17:20

4 265 0
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot

Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot

... construction of the poneratoxin gene [11]. Two oligonucleotides: forward 5¢- 2 GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-3¢, were ... the N-terminal fragment of the poneratoxin gene. Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GG...

Ngày tải lên: 30/03/2014, 13:20

10 696 0
Báo cáo khoa học: "Compiling a Lexicon of Cooking Actions for Animation Generation" doc

Báo cáo khoa học: "Compiling a Lexicon of Cooking Actions for Animation Generation" doc

... Generation Kiyoaki Shirai Hiroshi Ookawa Japan Advanced Institute of Science and Technology 1-1, Asahidai, Nomi, 923-1292, Ishikawa, Japan {kshirai,h-ookawa}@jaist.ac.jp Abstract This paper describes a system ... the module “Action Matcher”. Then, the system ex- tracts an action plan from the lexicon and passes it to the “Animation Generator” module. Finally An- imation Generator interp...

Ngày tải lên: 31/03/2014, 01:20

8 426 0
Từ khóa:
w