Báo cáo khoa học: "Unsupervised Learning of Arabic Stemming using a Parallel Corpus" pot

Báo cáo khoa học: "Unsupervised Learning of Arabic Stemming using a Parallel Corpus" pot

Báo cáo khoa học: "Unsupervised Learning of Arabic Stemming using a Parallel Corpus" pot

... subsequently aligned by automatic means. A small parallel corpus can be available when native speakers and translators are not, which makes building a stemmer out of such corpus a preferable direction. Arabic ... text. 1.1 Arabic details In this paper, Arabic was the target language but the approach is applicable to any language that needs affix removal. In Arabic, unlike Engl...

Ngày tải lên: 08/03/2014, 04:22

8 425 0
Báo cáo khoa học: "Unsupervised Learning of Acoustic Sub-word Units" pot

Báo cáo khoa học: "Unsupervised Learning of Acoustic Sub-word Units" pot

... available 1 in languages of immediate interest. What has been investigated is automatically learn- ing allophonic variations of each phoneme due to co-articulation or contextual effects (Takami ... speech 2 using a 1-state HMM with a diagonal-covariance Gaussian. (N =1.) 2 Note that the original application of SSS was for learning Figure 1: Modified four-way split of a state...

Ngày tải lên: 08/03/2014, 01:20

4 295 0
Tài liệu Báo cáo khoa học: "Automatic learning of textual entailments with cross-pair similarities" ppt

Tài liệu Báo cáo khoa học: "Automatic learning of textual entailments with cross-pair similarities" ppt

... examples al- lows a learning algorithm to automatically derive syntactic and lexical rules that can solve complex entailment cases. In this paper, we define a new cross-pair similar- ity measure based ... designed an effective way to automatically learn entailment rules from ex- amples and (b) our approach is highly accurate and exceeds the accuracy of the current state -of- the-art 40...

Ngày tải lên: 20/02/2014, 12:20

8 415 0
Tài liệu Báo cáo khoa học: "Unsupervised Segmentation of Chinese Text by Use of Branching Entropy" pdf

Tài liệu Báo cáo khoa học: "Unsupervised Segmentation of Chinese Text by Use of Branching Entropy" pdf

... Proceedings of the COLING/ACL 2006 Main Conference Poster Sessions, pages 428–435, Sydney, July 2006. c 2006 Association for Computational Linguistics 428 0.5 1 1.5 ... 4 5 6 7 8 entropy offset 429 430 431 432 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0.55 0.6 0.65 0.7 0.75 0.8 0.85 0.9 0.95 1 recall precision Bincrease Bordinary Bmax 433 0 0.1 0.2 ... 1 recall precision...

Ngày tải lên: 20/02/2014, 12:20

8 396 0
Tài liệu Báo cáo khoa học: "Semantic Classification of Noun Phrases Using Web Counts and Learning Algorithms" ppt

Tài liệu Báo cáo khoa học: "Semantic Classification of Noun Phrases Using Web Counts and Learning Algorithms" ppt

... effective algorithm for the classification task. Turney and Littman (2005) achieve an accuracy of 45.7%, where we achieve a maximum accuracy of 38.1% on this dataset using a nearest neighbor algorithm. ... senses and therefore accurately predict a se- mantic relation. 2.2 Machine Learning Algorithms We are also interested in comparing the perform- ance of machine learnin...

Ngày tải lên: 20/02/2014, 12:20

6 626 2
Tài liệu Báo cáo khoa học: "Online Learning of Approximate Dependency Parsing Algorithms" potx

Tài liệu Báo cáo khoa học: "Online Learning of Approximate Dependency Parsing Algorithms" potx

... Online Learning of Approximate Dependency Parsing Algorithms Ryan McDonald Fernando Pereira Department of Computer and Information Science University of Pennsylvania Philadelphia, PA 19104 {ryantm,pereira}@cis.upenn.edu Abstract In ... Parsing Secondary Parents Kromann (2001) argued for a dependency formal- ism called Discontinuous Grammar and annotated a large set of Danish sen...

Ngày tải lên: 22/02/2014, 02:20

8 417 0
Báo cáo khoa học: "Unsupervised Discovery of Rhyme Schemes" pdf

Báo cáo khoa học: "Unsupervised Discovery of Rhyme Schemes" pdf

... independent stanzas, with uniform initialization of θ. Rows labeled ‘All’ refer to training and evaluation on all the data in the language. Other rows refer to training and evaluating on a particular sub-corpus ... its pronunciation in that time or dialect, a fact that is often taken advantage of by linguists (Wyld, 1923). One could automate this task given enough annotated data. An o...

Ngày tải lên: 07/03/2014, 22:20

6 373 0
Tài liệu Báo cáo khóa học: The lysozyme of the starfishAsterias rubens A paradigmatic typei lysozyme docx

Tài liệu Báo cáo khóa học: The lysozyme of the starfishAsterias rubens A paradigmatic typei lysozyme docx

... (5¢fi3¢) Corresponding peptide AS1 GGTTGCCTGAGRTGYATHTG a GCLRCIC AS3 GGGCTATTGGTCAGACGCTACACTC GYWSDATL AS3R GAGTGTAGCGTCTGACCAATAGCC GYWSDATL AS4R GATCTGATACGGTCCACACGACAG LSCGPYQI a H ¼ A or C or T; R ¼ AorG;Y¼ ... 12 0A PTH analyser. Synthesis of cDNA Total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. It was treated with RNAa...

Ngày tải lên: 19/02/2014, 12:20

6 738 0
Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt

Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt

... Dynamic model-theoretic semantics allows the evaluation of a formula to cause the addition of information to the model. This interaction of the evaluation of a formula and the expansion of ... semantics provides a computationally attractive means of representing the semantics of natural language. However, the models used in this formalism are static and are usually...

Ngày tải lên: 21/02/2014, 20:20

3 397 0
Báo cáo khoa học: Biological role of bacterial inclusion bodies: a model for amyloid aggregation potx

Báo cáo khoa học: Biological role of bacterial inclusion bodies: a model for amyloid aggregation potx

... MINIREVIEW Biological role of bacterial inclusion bodies: a model for amyloid aggregation Elena Garcı ´ a- Fruito ´ s 1–3, *, Raimon Sabate 1,4, *, Natalia S. de Groot 1,4 , Antonio Villaverde 1–3 and Salvador ... Bioingenierı ´ a, Biomateriales y Nanomedicina (CIBER-BBN), Barcelona, Spain 4 Department of Biochemistry and Molecular Biology, Universitat Auto ` noma de Barcelona, Spain...

Ngày tải lên: 06/03/2014, 00:20

9 434 0
w