Báo cáo khoa học: "Transonics: A Practical Speech-to-Speech Translator for English-Farsi Medical Dialogues" docx

... 12CA5 mAb against HA was from Roche (Indianapolis, IN, USA), anti-HA clone HA.11 was from Covance (Berkely, CA, USA), anti-glutathione S-transferase (GST) and mAb against myc (9E10) were from Santa ... The Authors Journal compilation ª 2008 FEBS KCTD5, a putative substrate adaptor for cullin3 ubiquitin ligases Yolanda Bayo ´ n 1 , Antonio G. Trinidad 1 , Marı a L. de la Puerta 1 , Marı...

Ngày tải lên: 07/03/2014, 06:20

... excess of information. FAQ-pages tend to also answer questions which are not asked, and also con- tain practical examples. Human-powered answers often contain unrelated information and discourse- like ... each paid reward. • Qualifications To improve the data quality, a HIT can also be attached to certain tests, “qualifications” that are either system-provided or created by the requester. A...

Ngày tải lên: 20/02/2014, 09:20

... that when they are formulated loosely, as in the pre- vious paragraph, they appear to conflict. In par- ticular, in ( 2a) , Right Association seems to call for the parse that makes for Mary a ... Grammatical Relations, MIT Press, Cambridge. Carbonell, J., and Hayes, P. (1983). "Recovery Strategies for Parsing Extragrammatical Lan- guage", American Journal of Computat...

Ngày tải lên: 20/02/2014, 21:20

... length-based and integrates a shal- low content analysis. It begins by individuating a paragraph in the target text which is a first candi- date as target paragraph, and which we call "pivot". ... corpora are available, also the translation equivalents of the collocation context are displayed, thus allowing the user to see how a given collocation was translated in different...

Ngày tải lên: 22/02/2014, 02:20

... perfor- mance of WSD algorithms for languages such as English for which hand-crafted sense-annotated corpora have been available (Agirre et al., 2007; Erk and Strapparava, 2012; Mihalcea et al., ... amount of data that can reasonably be annotated by hand. Leacock et al. (1998), Agirre and Lopez de La- calle (2004), and Mihalcea and Moldovan (1999) propose a set of methods for automati...

Ngày tải lên: 22/02/2014, 03:20

... especially on grammatical theory - for example, Generalised Phrase Structure Grammar' (GPSG) (Gazdar et al., In Press), Lexical Functional Grammar (LFG) (Kaplan & Bresnan, 1982) - and ... systems for the syntactic analysis of substantial fragments of natural language. These developments also demonstrate that if natural language processing systems are to be able to handle...

Ngày tải lên: 22/02/2014, 09:20

... Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor. ... Yokohama, Japan 2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, Japan Introduction Type II transmembrane serine proteases...

Ngày tải lên: 15/02/2014, 01:20

... from bacterial genomics. Nat Prod Rep 24, 1073–1109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of angiotensin-converting enzyme, ... (Hartmann Analytic, Braunschweig, Germany) was added. The supernatants were extracted with XAD16 resin after an additional 2 days of growth. The dried eluate was dissolve...

Ngày tải lên: 16/02/2014, 09:20

... AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses Kristiina A. Vuori 1 , Johanna K. Ahlskog 2 , Lea Sistonen 2 and...

Ngày tải lên: 18/02/2014, 14:20

... Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H, Hamasaki K et al. (2003) Interferon -a sensitizes human hepatoma cells to TRAIL-induced apoptosis ... 40760–40767. 34 Yamada H, Tada-Oikawa S, Uchida A & Kawanishi S (1999) TRAIL causes cleavage of bid by caspase-8 and loss of mitochondrial membrane potential resulting in apoptosis in BJAB...

Ngày tải lên: 19/02/2014, 06:20