Tài liệu Báo cáo khoa học: "HOW TO MISREAD A DICTIONARY" pot

Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

... genome databanks. Interestingly, this domain was found in some closely related bacterial species, but mainly in nonvertebrate animals, and invariably connected via a linker to an animal-type a- amylase ... the noticeable exception of the a- amylase from the bacte- rium Pseudoalteromonas haloplanktis, which displays an additional small (21 kDa) C-terminal domain hav- ing the size of a...

Ngày tải lên: 14/02/2014, 18:20

8 629 0
Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

... an N-terminal hexahistidine tag was obtained by PCR using the pET2 1a ⁄ PNT- H6 plasmid [30] as the template. The forward primer (5¢-TACCGTTAACATCGATATGCATCATCATC ATCATCATGC-3¢) was designed to ... to thank Antonino Natalello and Silvia Maria Doglia for their assistance with the fluorescence spectroscopy, as well as for critically reading the manuscript. We are indebted to Maria Samalik...

Ngày tải lên: 18/02/2014, 04:20

14 675 0
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

... administration increased Q279E a- galactosidase A residual activity in patient derived cells; thus, galactose was demonstrated to be first active-site-directed pharmacologic chaperone for a lysosomal storage disease. ... mechanisms. Proc Natl Acad Sci USA 103, 13813–13818. 29 Yu L, Ikeda K, Kato A, Adachi I, Godin G, Compain P, Martin O & Asano N (2006) alpha-1-C-octyl-1-de- oxynoj...

Ngày tải lên: 18/02/2014, 16:20

7 507 0
Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf

Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf

... the top-down approach deserve consideration for important pro- teomics research. Acknowledgements We thank Barbara Baird, Ian Jardine, Neil Kelleher, Harold Scheraga and Klaas van Wyck for valuable discussions, ... these fragment mass values originate from the same molecular ions, so they must all be characteristic of that protein’s sequence and molecular mass value. Thus, top-down data can g...

Ngày tải lên: 18/02/2014, 16:20

13 573 0
Tài liệu Báo cáo khoa học: How does hepatitis C virus enter cells? pptx

Tài liệu Báo cáo khoa học: How does hepatitis C virus enter cells? pptx

... Kanto T, Hayashi N, Takehara T, Hagiwara H, Mita E, Naito M, Kasahara A, Fusamoto H & Kamada T (1994) Buoyant density of hepatitis C virus recovered from infected hosts: two different features ... protease and its cofactor NS 4A. In addition to the N-terminal protease domain, the carboxy-terminal domain of NS3 consists of an RNA helicase and NTPase activity. NS 4A serves as a cofact...

Ngày tải lên: 19/02/2014, 06:20

15 576 0
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt

Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt

... Sequence Forward ompA* 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG Reverse ompA105 5¢-GCCATGAATATCTCCAACGAG Reverse ompA117 5¢-CATCCAAAATACGCCATGAATATC Forward 5¢rpsO 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG Reverse ... 5¢-GCTTCAGTACTTAGAGAC Forward 3¢rpsO 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC Reverse 3¢rpsO 5¢-GAAAAAAGGGGCCACTCAGG Reverse 3¢rpsO-(T)18 5¢-T(18)GAAAAAAGGGGCCACTCAGG Forward rpsO...

Ngày tải lên: 19/02/2014, 16:20

10 488 0
Từ khóa:
w