Báo cáo khoa học: DNA mediated disassembly of hRad51 and hRad52 proteins and recruitment of hRad51 to ssDNA by hRad52 pot

In this work, we have studied the oligomeric states of hRad51 and hRad52 in the presence and absence of ssDNA.. hRad52 interacts specifically with higher oligomeric states of hRad51 in th

proteins and recruitment of hRad51 to ssDNA by hRad52 Vasundhara M Navadgi, Ashish Shukla, Rahul Kumar Vempati and Basuthkar J Rao

Department of Biological Sciences, Tata Institute of Fundamental Research, Mumbai, India

Human Rad51 protein (hRad51), a homologue of

Escherichia coli RecA performs the fundamental role

of homologous pairing and strand exchange during

homologous recombination and double-strand break

repair [1,2] Rad51 and Rad52 colocalize in distinct

nuclear foci in response to DNA damage [3] Yeast

rad52 mutants show extensive degradation of the

DNA double-strand break ends suggesting that Rad52

is critically involved in stable maintenance of

chromo-somal integrity [4] Cytological studies indicate that

Rad52 is required for Rad51 foci formation during

meiosis [5] and chromatin immunoprecipitation assays

demonstrated the requirement of Rad52 for association

of yeast Rad51 to HO induced double strand break

site at the MATa locus in vivo [6,7] Biochemically,

Rad52 stimulates the strand exchange activity of

Rad51 [8–10] and is shown to displace Replication

Protein A (RPA) [11,12] and stabilize the

Rad51-single-stranded (ssDNA) filament [13]

hRad51 and hRad52 form ring-shaped structures

like other recombination proteins RecA, RecT, human

Dmc1 and b protein from bacteriophage k [14–18] Rad51 and RecA bind DNA as helical filaments whereas their meiosis specific homologue Dmc1 and archaeal recombinase, RadA proteins, form stacked octameric rings on DNA in the absence of ATP and as helical filaments in the presence of ATP [18–20] The crystal structure of Pyrococcus furiosus Rad51 reveals that it forms a biheptameric ring [21] High-resolution crystal structural description of human Rad51, human Rad52 and human Dmc1 has delineated the complex-ity of homologous-pairing as well as the inter-subunit interaction domains [18,21–24] Structural studies with both Rad51 and RecA suggest two distinct oligomeric states of these proteins: rings and DNA-bound helical forms [21,25] Light scattering studies on RecA assem-bly have suggested that under some solution conditions free protein filament assembly effectively competes with RecA assembly on ssDNA [26,27] This property

of RecA seems to be evolutionarily conserved as archaeal RadA also forms long helical filaments even

in the absence of DNA and the protein assembles into

Keywords

DNA binding; homologous

recombination;oligomerization; Rad51;

Rad52

Correspondence

B.J Rao, Department of Biological

Sciences, Tata Institute of Fundamental

Research, Homi Bhabha Road, Colaba,

Mumbai 400 005, India

Fax: +91 22 22782606 ⁄ 22782255

Tel: +91 22 22804545 Extn: 2606

(Received 1 October 2005, accepted

10 November 2005)

doi:10.1111/j.1742-4658.2005.05058.x

Purified human Rad51 and Rad52 proteins exhibit multiple oligomeric states, in vitro Single-stranded DNA (ssDNA) renders high molecular weight aggregates of both proteins into smaller and soluble forms that include even the monomers Consequently, these proteins that have a pro-pensity to interact with each other’s higher order forms by themselves, start interacting with monomeric forms in the presence of ssDNA, presumably reflecting the steps of protein assembly on DNA In the same conditions, DNA binding assays reveal hRad52-mediated recruitment of hRad51 on ssDNA Put together, these studies hint at DNA-induced disassembly of higher-order forms of Rad51 and Rad52 proteins as steps that precede protein assembly during hRad51 presynapsis on DNA, in vitro

Abbreviations

ATPcS, Adenosine 5¢-O-(3-thiotriphosphate); hRad51, human Rad51; hRad52, human Rad52; ssDNA, single-stranded DNA.

shorter and thicker nucleoprotein filaments when

ssDNA is added [28] Tumour suppressors BRCA2

and p53 interact with the oligomerization domain of

Rad51 [24,29,30], and RPA is shown to inhibit the

higher order self association of hRad52 rings [31]

sug-gesting that oligomerization of Rad51 and Rad52 is

regulated by other molecules to control their activity

In this work, we have studied the oligomeric states

of hRad51 and hRad52 in the presence and absence of

ssDNA Our studies indicate that human Rad51, like

its bacterial homologue RecA exists in multiple

aggre-gation states [14,32] DNA seems to dissociate the

higher order structures of both hRad51 and hRad52

hRad52 interacts specifically with higher oligomeric

states of hRad51 in the absence of DNA, but with

hRad51 monomers when ssDNA is present These

results are rationalized through a model where we

pro-pose that the interaction between hRad52 and hRad51

monomers in the presence of DNA might be related to

the steps of protein recruitment during hRad51

pre-synapsis on ssDNA

Results and discussion

hRad51 is a 37-kDa protein whereas hRad52 is a

55-kDa protein Both of the proteins are known to

exist in oligomeric forms [15,20–23] Here, we describe

the changes associated with the aggregation states of

hRad51 and hRad52 in the presence of 121-mer

ssDNA and hRad52 mediated assembly of the

ssDNA–hRad51 complex The changes in the protein

aggregation states were monitored by three different

readouts: native PAGE, centrifugation assays, and

analyses of hydrodynamic radii changes by dynamic

light scattering (DLS)

ssDNA-induced disassembly of higher oligomeric

forms of hRad51

A fixed amount of hRad51 (7.5 lm) was incubated

with ssDNA (0–22 lm) as described in Experimental

procedures and analysed by native gel electrophoresis

(Fig 1A) and centrifugation assays (Fig 1B) hRad51

migrated as a highly aggregated form (several

hun-dred kDa complexes) that barely entered into the

gel Only a faint signal was detectable at the

mono-mer position (based on the mobility of standard

molecular weight markers) (lane 1, Fig 1A) In the

presence of ssDNA, the level of monomers increased

(compare lanes 2–4 with lane 1, Fig 1A) In these

gel conditions, even though ssDNA and hRad51

were migrating close to each other, there was enough

difference between the two to discern an increase in

the monomer level Using 5¢ 32P-labelled ssDNA, we mapped the positions of protein–DNA complexes in this gel system (data not shown; compare Fig 4) Based on this comparison, the protein–DNA com-plexes that entered into the gel mapped to the posi-tion indicated by the asterisk in Fig 1A The ssDNA mediated increase in monomer level remained essentially unchanged in the presence of nucleotide cofactors ADP, ATP or ATPcS (compare lanes 6–8, 10–12, 14–16 with of 2–4, respectively, Fig 1A) However, the signals associated with protein–DNA complexes (position indicated by asterisk) appear to diminish and that of higher oligomeric forms that enter into the gel (as labelled in Fig 1A) appear to increase in sets containing nucleotide cofactors This trend is consistent with ATP induced effects reported earlier, where much larger forms of hRad51 are dis-aggregated into oligomeric complexes equivalent to 3–8 protein monomers [33]

In order to trap the oligomeric forms that do not enter the gel, we used centrifugation assays Following the assay, we recovered a fraction of the protein in the pellet (lane 1, Fig 1B) and the remainder in the super-natant (lane 5) In the presence of ssDNA, the protein fraction that was pelletable became fully soluble, as no signal was recovered in the pellet (lanes 2–4) This effect suggested that addition of ssDNA renders pellet-able forms of protein aggregates into smaller and more soluble forms Consequently, the resultant ssDNA– protein complexes formed (see Fig 5) are soluble as they are recovered in the supernatant fraction of the assay Both of the assays suggested that addition of ssDNA facilitates significant level of disaggregation in hRad51

To reconfirm the DNA mediated disaggregation of hRad51, we analysed the hydrodynamic radii (Rh) of hRad51 as a function of ssDNA using dynamic light scattering studies Monomodal distribution of Rh val-ues (in nm) vs intensity is plotted as histograms where the observed Rh distribution (10–80 nm range) is grouped into categories (a–d) for easy comparison between samples (Fig 1C) It is to be noted that under these conditions, buffer components as well as naked ssDNA in solution hardly scatter any light, thereby yielding no detectable DLS signal in this Rh range The free protein showed a distribution of Rh ranging from 30 to 80 nm sizes (grouped as b, c and d in Fig 1C) Upon ssDNA addition, the distribution shif-ted towards smaller Rhvalues (10–20 nm size, grouped

as a) with a concomitant drop in the levels of larger ones (grouped as c and d) As a result, at the highest concentration of DNA, the distribution revealed a high preponderance of smaller protein particles and reduced

level of larger ones, thereby corroborating the effect of

ssDNA induced disaggregation of hRad51

DNA/ATP induced changes in hRad51

We tested whether DNA induced disaggregation of

protein leads to changes in the pattern of limited

teolysis of hRad51 by trypsin, where the extent of

pro-tease attacks is a function of both conformational as

well as overall organizational changes in the target

protein system Comparison revealed that hRad51 is

relatively more protected in the presence of ssDNA

than in its absence (compare lanes 4 and 5 with lanes

2 and 3, respectively, Fig 1D) This effect might

arise either due to steric hindrance imparted by ssDNA

binding or to changes in protein configuration⁄

conformation following ssDNA binding or a combina-tion of both ATP has been shown to induce changes

in hRad51 such that accessibility to protease attacks is altered [33] We observed that ATP induced change was somewhat different from that induced by ssDNA (compare lane 3 with lane 4) Note the increase in small sized proteolytic product (indicated by arrow-head 3) with the concurrent decrease in large fragment (indicated by arrowhead 1) in the ATP lane (lane 3) However compared to the control (lane 2), presence of ATP results in an increase in the larger fragment (indi-cated by arrowhead 2, lane 3) The appearance of large fragments in the presence of ATP (compare lane 3 with lane 2) or ssDNA (compare lanes 4 and 5 with lanes 2and 3, respectively) hint that these binders induce discernable changes in hRad51 organization

Fig 1 DNA induced solublization of Human Rad51 protein (A) Native gel assay to visualize oligomeric state of hRad51 hRad51 (7.5 l M ) was incubated with 0, 7.5, 15 and 22 l M oligo PUC+ in buffer containing 30 m M Tris ⁄ HCl pH 7.5, 1 m M MgCl 2 , 20 m M KCl and 1 m M DTT either in the absence of nucleotide cofactors (lanes 1–4) or in the presence of 1 m M ADP (lanes 5–8), 1 m M ATP (lanes 9–12), 1 m M ATPcS (lanes 13–16) and analysed by native PAGE ( 6% acrylamide) followed by silver staining (B) Centrifugation assay hRad51 was incubated with varying concentrations of DNA as described in (A) in the absence of any nucleotide cofactors and later subjected to centrifugation and the resulting pellet and supernatant were analysed by SDS PAGE followed by silver staining (C) Dynamic light scattering to study the effect

of DNA on hydrodynamic radius (Rh) of hRad51 hRad51 (1 l M ) was incubated with 0, 1, 3, 4 and 5 l M of oligo PUC+ (in the absence of any nucleotide cofactor) followed by the measurement of hydrodynamic radius of the protein molecules Monomodal distribution of R h values (in nm) vs intensity is plotted as histograms where groupings a–d depicts 10–80 nm range distribution (D) Partial proteolysis experiment to analyse DNA induced conformational changes on hRad51 protein hRad51 (25 l M ) was incubated in binding buffer in the absence (lanes 2 and 3) or presence of 75 l M ssDNA (lanes 4 and 5) and 1 m M ATP (lanes 3 and 5) for 1 h at 37
C and then subjected to partial digestion with trypsin (Sigma, Munich, Germany) (50 lgÆmL)1) for 1 min The reaction was quenched by Laemmli buffer and analysed by SDS ⁄ PAGE (20% acrylamide), followed by silver staining Lane 6 consists of only ssDNA.

DNA-induced disassembly of higher oligomeric

forms of hRad52

A similar effect of disaggregation by ssDNA was also

observed with hRad52 protein In the absence of

ssDNA, hRad52 protein appeared to be so highly

aggregated that it hardly entered into the gel (lane 5,

Fig 2A) and was mostly in the pellet fraction following

a centrifugation assay (lane 1, Fig 2B) Aggregation of

hRad52 appears to be highly salt sensitive and in the

present assay conditions with 20 mm KCl, the protein

remains highly aggregated The addition of ssDNA

ren-dered the protein into forms that not only entered into

the gel, but also migrated as the monomeric form This

effect was further evidenced by the complete recovery

of the protein in the supernatant fraction, as a function

of added ssDNA (lanes 7 and 8, Fig 2B)

Protein aggregation/disaggregation changes vs ionic effects

In order to assess whether ssDNA induced diaggrega-tion of hRad52⁄ hRad51 proteins reflects anionic effects contributed by ssDNA, we tested another relevant anion ATP and compared with its counter-cation Mg2+in the same assays A titration with varying ATP concentra-tions had no effect on hRad52 sedimentation properties Most protein that was in pellet fraction of the assay remained so even after the addition of 5 mm ATP (Fig 3A), suggesting that anionic ATP had no effect on protein aggregation As a control, we compared hRad51 protein in the same assay ATP, a known modulator of hRad51 function, caused protein disaggregation, as evi-denced by significant recovery of hRad51 in the super-natant fraction of the assay (Fig 3A) This effect is consistent with an increase in the level of higher oligo-meric forms of protein that enter into the gel due to ATP (compare lane 9 with lane 1, Fig 1A) However, unlike with ssDNA where the entire protein fraction was rendered soluble by 7.5–15 lm nucleotide concen-tration of DNA (Fig 1B), only a fraction of protein sample became soluble with as high as 5 mm ATP (Fig 3A), suggesting that the effects were distinct and not related to general ionic conditions in the assay This conclusion was further strengthened when the protein aggregation was tested as a function of Mg2+ In the same assay, Mg2+titration rendered hRad52 highly sol-uble, whereas hRad51 was highly insoluble (Fig 3B) A significant fraction of pelletable hRad52 was recovered

in the supernatant fraction following Mg2+ treatment, indicating that the protein was subject to solublization not only by ssDNA (Fig 2A and B), but also by Mg2+ (Fig 3B), a common effect facilitated by oppositely charged ionic species On the other hand, hRad51 exhib-ited a behaviour opposite to that of hRad52 by under-going high level of aggregation, which is akin to that

of E coli RecA aggregation induced by Mg2+observed earlier [32] These studies indicate that hRad52⁄ hRad51 disaggregation⁄ aggregation properties assayed here reflect genuine modulations rendered by ssDNA⁄ ATP⁄ Mg2+, etc rather than nonspecific ionic effects in solution conditions

hRad52 protein selectively interacts with higher oligomeric forms of hRad51 in the absence of DNA

As seen in earlier experiment, hRad51 exhibited multiple oligomeric forms (lane 1, Fig 4A) whereas hRad52 was in an aggregated state and hardly entered into the gel (lane 5, Fig 4A) hRad51 (10 lm) was

A

B

Fig 2 DNA induced solublization of Human Rad52 protein (A)

Native gel to visualize oligomeric state of hRad52 hRad52 (10 l M )

was incubated with 0, 10, 20 and 30 l M (lanes 1–4) oligo PUC+ in

buffer containing 30 m M Tris pH 7.5, 1 m M MgCl 2 , 20 m M KCl and

1 m M DTT and analysed by native PAGE (6% acrylamide) followed

by silver staining (B) Centrifugation assay hRad52 was incubated

with varying concentrations of DNA as described in (A) and later

subjected to centrifugation and the samples analysed by SDS

PAGE followed by silver staining.

incubated with increasing concentrations of hRad52

(0–10 lm) in the absence of ssDNA; this led to a

grad-ual and selective disappearance of higher oligomeric

states of hRad51, whereas the smaller forms of

hRad51 were largely unaffected (lanes 2–4, Fig 4A)

At the highest concentration of hRad52, most of

higher oligomeric forms of hRad51 were converted

into large complexes that did not enter the gel

(Fig 4A) These complexes were present in the pellet

fraction in a centrifugation assay (data not shown)

Earlier studies had shown that yeast Rad51 and Rad52

also form large complexes that elute much earlier than

individual proteins in gel filtration chromatography

experiment [34]

Recruitment of hRad51 to ssDNA targets: the role

of hRad52

We addressed this issue by analysing the status of

sol-uble forms of hRad51 protein as a function of

increas-ing hRad52 protein in the presence of ssDNA As

expected, native gel analyses revealed DNA (25 lm)

induced ‘monomerization’ of hRad51 protein (10 lm)

(compare lanes 2 and 7 with lanes 1 and 6,

respect-ively, Fig 4B) In this native gel assay conditions, the

‘monomerized’ form of hRad52 essentially comigrates

with that of hRad51 monomer (compare lanes 2 and 7

with lane 11, Fig 4B) Interestingly, addition of

hRad52 protein led to a measurable depletion rather

than a cumulative increase in the monomer signal of

both proteins (compare lanes 5 and 10 with 2–4 and

7–9, respectively, Fig 4B) This was concomitantly associated with the rise of a signal at high molecular weight region in the gel (at asterisk position in lanes

5 and 10) This was observed both with and without ATP

In parallel, we studied protein binding to 5¢ 32 P-labelled ssDNA of 121-mer (used in the previous experiments) and analysed the complex formation by native gel electrophoresis Increasing concentration of hRad51 led to the generation of protein–DNA com-plexes The complexes formed at low protein concen-trations were presumably smaller in size and hence entered into the gel (small protein–DNA complexes, Fig 5) and those at high protein concentrations were much larger and retained at the top of the gel (large protein–DNA complexes) Moreover, there appeared

to be a precursor–product relationship between the small and large complexes, where the appearance of large complexes was concomitantly associated with the disappearance of small ones To assess the role of hRad52 on hRad51 binding, we performed gel shift analyses of complexes at a limiting amount of hRad51 (1 lm) in the presence of increasing levels of hRad52 The control experiment revealed that in these condi-tions, the hRad52 protein by itself showed only margi-nal binding (lanes 10 and 11) In the set containing hRad51 protein, addition of hRad52 protein converted free DNA as well as ‘small protein–DNA complexes’ (lane 7) into much ‘larger complexes’ (lanes 8 and 9, Fig 5) Comparison of gel-shifted complexes in lanes 8 and 9 with those in lanes 3, 4 and 5 reveals that the

Fig 3 Aggregation ⁄ disaggregation of hRad51 ⁄ hRad52 proteins vs ionic effects (A) hRad51 (10 l M ) and hRad52 (10 l M ) were incubated in buffer (30 m M Tris ⁄ HCl pH 7.5, 1 m M MgCl2, 20 m M KCl, 1 m M DTT) containing varying concentrations of ATP, for 30 min at 37
C, followed

by centrifugation and analyses of pellet ⁄ supernatant fractions by SDS PAGE (B) In separate sets, hRad51 (10 l M ) or hRad52 (10 l M ) was incubated in buffer (30 m M Tris ⁄ HCl pH 7.5, 20 m M KCl, 1 m M DTT) containing varying concentrations of MgCl 2 for 30 min at 37
C, fol-lowed by centrifugation and analyses of pellet ⁄ supernatant fractions by SDS PAGE.

presence of hRad52 renders much better binding of

hRad51 to ssDNA even at lower concentrations of the

latter, thereby implying that hRad52 plays a role in

the recruitment of hRad51 to ssDNA

The results described in this study help us to

under-stand the transitions associated with the oligomeric

states of hRad51 and hRad52 proteins in the presence

of ssDNA and relate them to their DNA binding

activity The observation that hRad51 protein in its DNA-unbound form, exits in higher oligomeric forms, poses a mechanistic challenge as to how such struc-tures transform into right-handed helical filaments during⁄ following DNA binding Whether higher oligo-meric states of protein are directly recruited to DNA

or much smaller forms of the protein are generated prior to active assembly, is an open question Our results suggest that transient contacts of DNA strands with either protein create an effect of ‘protein disaggre-gation’ It is important to note that all the effects uncovered in the present study are from in vitro analy-ses and it is not clear how these effects may relate to the situations in vivo, the mechanistic description of which is not very clear at present

A large body of experimental evidence available in the literature suggests that Rad52 functions as a stimu-lator of Rad51 mediated recombination [8–10], and it has been postulated that these effects of Rad52 are lar-gely due to its role as a recruiter of Rad51 to DNA Our study extends this hypothesis further by showing that the recruitment of hRad51, mediated by hRad52, might encompass steps where the two proteins together undergo large-scale disaggregation in the presence of ssDNA, followed by interaction between the two at the level of monomeric forms, leading to an active faci-litated assembly of protein–DNA complexes We want

to end with a note of caution: we believe that purified hRad52⁄ hRad51 system is a highly complex organiza-tion and is difficult to probe by high-resoluorganiza-tion analy-ses at its equilibrium state We believe that the simple biochemical readouts used in the current study have

A

B

Fig 4 Effect of DNA on the interaction of hRad51–hRad52 (A)

hRad52 selectively interacts with higher oligomeric forms of

hRad51 in the absence of DNA Rad51 (10 l M ) was incubated with

0, 2.5, 5.0 and 10 l M (lanes 1–4) of hRad52 in binding buffer (see

Experimental procedures) containing 50 m M KCl at 37
C for 1 h

and analysed by native PAGE (6% acrylamide) followed by silver

staining Lane 5 contains 10 l M hRad52 alone (B) hRad52 interacts

with hRad51 monomers in the presence of DNA hRad51 (10 l M )

was incubated with 0, 2, 4 and 10 l M (lanes 2–5 and 7–10) of

hRad52 in the presence of 25 l M oligo PUC+ in binding buffer

con-taining 50 m M KCl either in the absence (lane 1–5) or presence of

1 m M ATP (lane 6–10) and analysed by native PAGE (6%

acryl-amide) followed by silver staining Lane 1 and 6 has hRad51

(10 l M ) without DNA and lane 11 had hRad52 (10 l M ) with DNA.

The position of asterisk indicates the formation of large complex in

the presence of hRad51, hRad52 and ssDNA.

Fig 5 hRad51 binding to ssDNA in the presence of hRad52 32 P labelled oligo PUC+ (1 l M ) was incubated with 0, 1, 2, 3, 6 l M

hRad51 (lanes 1–5) in the absence of hRad52 and 1 l M hRad51 with 0, 0.25 and 0.50 l M hRad52 (lanes 6–9) Lanes 10 and 11 con-tain DNA samples incubated with hRad52 alone Samples were resolved by native PAGE (6% acrylamide) and the gel was scanned using a PhosphorImager.

provided some useful clues on important

organiza-tional changes that ensue in protein during their

recruitment to ssDNA However the results are limited

by the resolution limits imposed by the assays

Experimental procedures

Materials

T4 polynucleotide kinase, ATP, ADP were from Amersham

life Sciences (Piscataway, NJ, USA) ATPcS was obtained

from Roche-Molecular Biochemicals (Mannheim, Germany)

Ni–NTA agarose beads were from Qiagen (Hiden,

Germany) Oligonucleotides were from DNA technology

(Aarhus, Denmark)

DNA substrate

The sequence of the 121-mer ssDNA substrate

PUC+, used in this study was: 5¢—TTTCCCAGTCACGA

CGTTGTAAAACGACGGCCAGTGCCAAGCTTGCAT

GCCTGCAGGTCGACTCTAGAGGATCCCCGGGTAC

CGAGCTCGAATTCGTAATCATGGTCATAGCTGTTT

CCT—3¢ DNA concentrations are expressed as total

nucleo-tide concentrations The oligonucleonucleo-tide used in the current

study was more than 90% pure, as assessed by 8 m

urea-containing denaturing PAGE End labelling of

oligonucleo-tides was carried out as described earlier [35]

Purification of hRad51 and hRad52

The hRad52 overexpressing clone was obtained from Steve

West (Cancer Research UK, London, UK, earlier ICRF,

London, UK) Protein was purified as described [35] The

hRad51 overexpression plasmid was obtained from Hitoshi

Kurumizaka (Wako, Saitama, Japan) and purified as

described [36]

Centrifugation assay

Reaction mixtures containing DNA and protein (as

des-cribed in the figure legends) were incubated in binding

buffer [30 mm Tris⁄ HCl pH 7.5, 1 mm MgCl2, 1 mm

di-thiothreitol (DTT)] at 37
C for 1 h Samples were

subjec-ted to centrifugation at 14 000 r.p.m for 10 min The

supernatant and pellet were separated and heated in

Laemmli buffer at 90
C for 10 min and analysed by

SDS⁄ PAGE (10% acrylamide), followed by silver staining

Native polyacrylamide gel electrophoresis

of proteins

Varying concentrations of Rad51, Rad52 and DNA were

incubated in specific conditions (as described in the figure

legends) at 37
C for 1 h Samples were subjected to native PAGE (6% acrylamide) in TBE buffer at 200 V for 3 h at room temperature (25
C) Subsequently the proteins were visualized by silver staining

DNA binding by gel-shift assays Labelled DNA substrate was incubated with various con-centrations of hRad51 and hRad52 (as described in the fig-ure legends) in a binding buffer (30 mm Tris⁄ HCl pH 7.5,

1 mm MgCl2, 1 mm DTT, 100 lgÆmL)1 BSA) at 37
C for

1 h DNA–protein complexes were analysed by native PAGE (6% acrylamide) in TBE buffer at 200 V for 3 h at room temperature (25
C) The radioactivity in the gels was quantified by ImageQuant software on a Phosphor-Imager (Molecular Dynamics, Piscataway, NJ, USA) Dynamic light scattering

Measurement of hydrodynamic radius Dynamic light scattering experiments were performed at

22
C on a DynaPro-MS800 dynamic light scattering instru-ment (Protein Solutions Inc., VA, USA) Buffer solutions were filtered carefully through 20-nm filters (Whatman Ano-disc 13) to remove dust particles The particulate matter, if any, in the DNA and protein samples, were removed by sub-jecting the samples to centrifugation (14 000 r.p.m) at 4
C for 10 min hRad51 (1 lm) was incubated with different con-centrations of DNA (as mentioned in the legends) in a 50-lL reaction buffer (30 mm Tris⁄ HCl pH 7.5, 1 mm MgCl2,

1 mm DTT) in the absence of any nucleotide cofactor for 10–

15 min in a quartz cuvette followed by DLS analysis It was ascertained that the buffer system was free of particles as reflected by very low Rh(0.1–0.2 nm) values associated with

it The data were analysed using Dynamics software, which reported the hydrodynamic radii (Rh) for monomodal distri-butions as defined by a baseline from 0.9 to 1.001

Acknowledgements

We thank Steve West, Cancer Research, UK, and Hitoshi Kurumizaka, Japan for hRad52 and hRad51 overexpression clones, respectively

References

1 West SC (2003) Molecular views of recombination pro-teins and their control Nat Rev Mol Cell Biol 4, 435–445

2 Sung P, Krejci L, Van Komen S & Sehorn MG (2003) Rad51 recombinase and recombination mediators

J Biol Chem 278, 42729–42732

3 Liu Y & Maizels N (2000) Co-ordinated response of mammalian Rad51 and Rad52 toDNA damage EMBO Rep 1, 85–90

4 Sugawara N & Haber JE (1992) Characterization of

double-strand break-induced recombination: homology

requirements and single-stranded DNA formation Mol

Cell Biol 12, 563–575

5 Gasior SL, Olivares H, Ear U, Hari DM, Weichselbaum

R & Bishop DK (2001) Assembly of RecA-like

recombi-nases: distinct roles for mediator proteins in mitosis and

meiosis Proc Natl Acad Sci USA 98, 8411–8418

6 Sugawara N & Wang X, Haber JE (2003) In vivo roles

of Rad52, Rad54, and Rad55 proteins in

Rad51-mediated recombination Mol Cell 12, 209–219

7 Wolner B, Van Komen S, Sung P & Peterson CL (2003)

Recruitment of the recombinational repair machinery to

a DNA double-strand break in yeast Mol Cell 12,

221–232

8 Benson FE, Baumann P & West SC (1998) Synergistic

actions of Rad51 andRad52 in recombination and

DNA repair Nature 391, 401–404

9 Shinohara A, & Ogawa T (1998) Stimulation by Rad52

of yeast Rad51-mediated recombination Nature 391,

404–407

10 New JH, Sugiyama T, Zaitseva E & Kowalczykowski

SC (1998) Rad52 protein stimulates DNA strand

exchange by Rad51 and replication protein A Nature

398, 407–410

11 Sung P (1997) Function of yeast Rad52 protein as a

mediator between replication protein A and the Rad51

recombinase J Biol Chem 272, 28194–28197

12 Sugiyama T.& Kowalczykowski SC(2002) Rad52

pro-tein associates with replication ropro-tein A (RPA)-single

stranded DNA to accelerate Rad51 mediated

displace-ment of RPA and presynaptic complex formation

J Biol Chem 277, 31663–31672

13 New JH & Kowalczykowski SC (2002) Rad52 protein

has a second stimulatory ole in DNA strand exchange

that complements Replication protein–A function

J Biol Chem 277, 26171–26176

14 Baumann P, Benson FE, Hajibagheri NMA & West SC

(1997) Purification of human Rad51 protein by selective

spermidine precipitation Mutat Res DNA Repair 384,

65–72

15 Stasiak AZ, Larquet E, Stasiak A, Muller S, Engel A,

Van dyck E, West SC & Egelman EH (2000) The

human Rad52 protein exists as a heptameric ring Curr

Biol 10, 337–340

16 Thresher RJ, Makhov AM, Hall SD, Kolodner R &

Griffith JD (1995) Electron microscopic visualization of

RecT protein and its complexes with DNA J Mol Biol

254, 364–371

17 Passy SI., YuX, Li Z, Radding CM & Egelman EH

(1999) Rings and filaments ofB protein from

bacterio-phage 1 suggest a superfamily of recombination

pro-teins Proc Natl Acad Sci USA 96, 4279–4284

18 Kinebuchi T, Kagawa W, Enomoto R, Tanaka K,

Miyagawa K, Shibata T, Kurumizaka H & Yokoyama

S (2004) Structural basis for octameric ring formation and DNA interaction of the human homologous-pairing protein Dmc1 Mol Cell 14, 363–374

19 Sehorn MG, Sigurdsson S, Bussen W, Unger VM & Sung P (2004) Human meiotic recombinase Dmc1 pro-motes ATP-dependent homologous DNA strand exchange Nature 429, 433–437

20 Yang S, Yu X, Seitz EM, Kowalczykowski SC & Egel-man EH (2001) Archaeal RadA protein binds DNA as both helical filaments and octameric rings J Mol Biol

314, 1077–1085

21 Shin DS, Pellegrini L, Daniels DS, Yelent B, Craig L

& Bates D., YuDS, Shivji MK, Hitomi C, Arvai AS, Volkmann N, Tsuruta H, Blundell TL, Venkitaraman

AR & Tainer JA (2003) Full length archaeal Rad51 structure and mutants: mechanisms for Rad51 assem-bly and control by BRCA2 EMBO J 22,.4566– 4576

22 Kagawa W, Kurumizaka H, Ishitani R, Fukai S, Nureki

O & Shibata T & Yokoyama S (2002) Crystal structure

of the homologous-pairing domain from the human Rad52 recombinase in the undecameric form Mol Cell

10, 359–371

23 Singleton MR, Wentzell LM, Liu Y, West SC & Wigley

DB (2002) Structure of the single-strand annealing domain of human Rad52 protein Proc Natl Acad Sci USA 99, 13492–13497

24 Pellegrini L, Yu DS, Lo T, Anand S, Lee M, Blundell

TL & Venkitaraman AR (2002) Insights into DNA recombination from the structure of a Rad51-BRCA2 complex Nature 420, 287–293

25 Story RM, Weber IT & Steitz TA (1992) The structure

of the E.coli recA protein monomer and polymer Nature 355, 318–325

26 Morrical SW & Cox MM (1985) Light scattering studies

of the recA protein of Escherichia coli: relationship between free recA filaments and the recA X ssDNA complex Biochemistry 24, 760–767

27 Masui R, Mikawa T, Kato R & Kuramitsu S (1998) Characterization of the oligomericstates of RecA pro-tein: Monomeric RecA protein can form nucleoprotein filament Biochemistry 37, 14788–14797

28 Lee MH, Leng CH, Chang YC, Chou CC, Chen YK, Hsu FF, Chang CS, Wang AH & Wang TF (2004) Self-polymerization of archaeal RadA protein into long and fine helical filaments Biochem Biophys Res Commun

323, 845–851

29 Yu DS, Sonoda E, Takeda S, Huang CL, Pellegrini L & Blundell TL & Venkitaraman AR (2003) Dynamic con-trol of Rad51 recombinase by self association and inter-action with BRCA2 Mol Cell 12, 1029–1041

30 Buchhop S, Gibson MK, Wang XW, Wagner P, Stur-zbecher HW & Harris CC (1997) Interaction of p53 with the human Rad51 protein Nucl Acids Res 25, 3868–3874

31 Jackson D, Dhar K, Wahl JK, Wold MS & Borgstahl

GE (2002) Analysis of thehuman replication protein A:

Rad52 complex: evidence for crosstalk between

RPA32,RPA70, Rad52 and DNA J Mol Biol 321,

133–148

32 Brenner SL, Zlotnick A & Griffith JD (1988) RecA

pro-tein self-assembly Multiple discrete aggregation states

J Mol Biol 204, 959–972

33 Tombline G, Heinen CD, Shim KS & Fishel R (2002)

Biochemical characterization of the human Rad51

pro-tein Modulation of DNA binding by adenosine

nucleo-tides J Biol Chem 277, 14434–14442

34 Song B & Sung P (2000) Functional Interactions among yeast Rad51 recombinase, Rad52 mediator, and replica-tion protein A in DNA strand exchange J Biol Chem

275, 15895–15904

35 Navadgi VM, Dutta A & Rao BJ (2003) Human Rad52 facilitates three-stranded pairing that follows no strand exchange: A novel pairing function of the protein Biochemistry 42, 15237–15251

36 Kurumizaka H, Aihara H, Kagawa W, Shibata T & Yokoyama S (1999) Human Rad51 amino acid residues required for Rad52 binding J Mol Biol 291, 537–548