... al .: Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L. ) as a tool for the determination of key events in sexual plant reproduction. BMC Plant Biology ... RESEARC H ARTIC L E Open Access Whole-Organ analysis of calcium behaviour in the developing pistil of olive (O...
Ngày tải lên: 11/08/2014, 11:21
... analysis of dopamine and a- synuclein interplay in a cellular model of Parkinson’s disease pathogenesis Tiziana Alberio 1 , Alessandra Maria Bossi 2 , Alberto Milli 2 , Elisa Parma 1 , Marzia Bruna Gariboldi 1 , Giovanna ... b-gal cells in the presence of catalase only (cat) or in the presence of catalase and 0.250 mm dopamine for 24 h (DA). Dopamine treat- ment signi...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Kinetic analysis of effector modulation of butyrylcholinesterase-catalysed hydrolysis of acetanilides and homologous esters pdf
... acetylcholinesterase from eel and basal ganglia: effect on the acetylcholinesterase and aryl acylamidase activities. Biochemistry 23, 4088–4093. 31 Boopathy R & Balasubramanian AS (198 5) Chemical modification ... potential detoxification role of the AAA activity of BuChE needs to be addressed. Known AAAs are serine hydrolases that catalyse the deacylation of N-acyl arylami...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Quantitative analysis of the experimental O–J–I–P chlorophyll fluorescence induction kinetics Apparent activation energy and origin of each kinetic step Steve Boisvert, David Joly and Robert Carpentier doc
... numerical data also demonstrated that this decrease was compensated for by an increase in the J–I phase. We also observed that half-times at 15 °C were always higher than at 25 °C for all steps in all ... limited information. In particular, the characteristics of the J–I phase are almost impossible to determine from vis- ual analysis of the traces. It was shown that t...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf
... conditions of the assay, the intramolecular cyclization of glutaminyl to pyroglutamyl at the N-terminus of ONC (M2 3L) is not accelerated by lowering the pH, as observed for free L- Gln in aqueous solutions ... can be completed in as little as 3 h at 70 °C (4 h after the addition of the exopeptidase). Preparative activation Activation of (Pyr)-ONC (M2 3L) wa...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: Thermodynamic analysis of porphyrin binding to Momordica charantia (bitter gourd) lectin pptx
... water-soluble porphyrins with lectins. In the initial studies, we character- ized the interaction of several f ree-base and metalloporphy- rins with plant lectins s uch as concanavalin A ( ConA), pea lectin, ... 10 5 M )1 . Interestingly, the fact that auxins and cytokinins function as plant growth regulators [46] suggests that these molecules may a ct as endogenou...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Subproteomics analysis of Ca2+-binding proteins demonstrates decreased calsequestrin expression in dystrophic mouse skeletal muscle pdf
... ÔStains- AllÕ labelling did not result in suitable mass spe ctra for the proper identification of Ca 2+ -binding proteins (data not shown). The analysis of ÔStains-AllÕ labelled spot no. 8, using a ... gel in a stainless steel tray. The tray was then placed on top of a hot plate and the temperature maintained at 9 0 °C for 5 min to aid the staining of protein...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Functional analysis of the basic helix-loop-helix transcription factor DEC1 in circadian regulation ppt
... and 5¢-GCAGCAGGATCCTCTAGAGAGTTTAGTC TTTG-3¢ for FLAG-DEC1; and 5 ¢-GAATTCGGCGG ACCAGAGAATGGACATTTCCTCAACCATC-3¢ and 5¢-TCTAGACTACAGCGGCCATGGCAAGTCACTAA AGTC-3¢ for FLAG-BMAL 1) were used for amplification by ... t-test).TheregionsofBMAL1expressedasaGAL4fusion protein are schematically shown in the upper panel. The basic helix- loop-helix (bHLH), PAS -A and PAS-B domains [32] ar...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... PCR fragment was generated using primer CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3 )( N¼ A, T, G, C) and ... Denmark). DNA techniques All manipulations were performed as described by Sambrook et al. [24]. Taq DNA polymerase (New England Biolabs, Frankfurt am Main, Germany) was applied for analytic...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf
... the fraction of the total amount of PAI-1 forming a stable complex with uPA, was calculated from the amount of PAI-1 required to inhibit half the uPA. The half-life of PAI-1 was finally calculated ... activity below 20 %) was added to each well followed by incubation for at least 5 min to allow complex formation between uPA and PAI-1. The remaining uPA activity in...
Ngày tải lên: 20/02/2014, 11:20